Labshake search
Citations for GenScript :
351 - 400 of 901 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... XM:006510629.3 ORF sequence) cDNAs cloned into the pcDNA3.1+/C-(k)-DYK vectors were obtained from GenScript. For the electrophysiological recordings of the Na+ currents ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transiently transfected with a pcDNA3.1 vector that expressed a C-terminally Flag-tagged AFG3L2 (GenScript) with the indicated single-point mutations ...
-
bioRxiv - Biochemistry 2019Quote: ... P116A/Y117Q and P142A/Y143Q mutants with a C terminal FLAG tag were synthesized by Genscript (genscript.com).
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Immunology 2020Quote: ... with a plasmid containing the complete human ACE2 transcript variant 1 cDNA sequence (NM_001371415.1) cloned into the mammalian expression vector pcDNA3.1-C’ FLAG by Genscript. Cells were grown in Iscove’s Modified Dulbecco’s Medium (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Neuroscience 2023Quote: ... the complete open reading frame of mouse NaV1.7 was cloned into the pcDNA3.1(+)-C-DYK vector (GenScript) with several modifications ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Physiology 2024Quote: ... Human HSD17B13 (NCBI Accession number: NM_178135.5) with HA-tag on the C-terminus was cloned into pcDNA3.1 (Genscript). HEK293 cells and HepG2 cells were transfected with HSD17B13 or empty control vector using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2023Quote: The open reading frame of full-length human GPNMB (NM_001005340.2) cloned into pcDNA3.1-C-EGFP was purchased from GenScript. pcDNA3.1-GPNMB-EGFP-G375V ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... The 5’UTR of TV1 was amplified from a DNA fragment purchased from Genscript. Each TV was amplified using primers that contain restriction enzyme sites for NheI and cloned into the psiCHECK-2 vector ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2022Quote: The human SNX25 open reading frame (ORF) cloned into the pcDNA3.1+-C DYK was obtained from Genscript (NM_031953). This expresses a C-terminally tagged SNX25 (SNX25-FLAG ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length codon-optimized yeast HSP104 fused C-terminally to an HA-tag was expressed from pcDNA3.1 (Genscript). Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript) ...
-
bioRxiv - Biochemistry 2022Quote: Peptides used for co-crystallization were synthesized and amidated at the C-terminus (Genscript, RIKEN Research Resource Center). Peptide used for fluorescence polarization assays were synthesized with an additional N-terminal 5-FAM.
-
bioRxiv - Immunology 2022Quote: ... and incubated at 37°C with different concentrations (10 μM, 2.5 μM and 0.0625 μM) of synthetic peptides (GenScript) or chymotrypsin-digested gluten (100 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2019Quote: ... Lysate supernatants were incubated overnight at 4°C with anti-flag monoclonal antibody coated on agarose beads (Genscript). The beads were then washed five times in wash buffer (50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2019Quote: The cDNA for Rab8a (residues 1-181, Q67L) lacking the flexible C-terminal tail was ordered from Genscript in a codon-optimized form to enable E.coli expression ...
-
bioRxiv - Microbiology 2021Quote: The CAN97-83 HMPV N0-P construct with a 6X C-terminal His6-tag was synthesized by GenScript in the pET-29b(+ ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...