Labshake search
Citations for GenScript :
451 - 500 of 901 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Microbiology 2023Quote: ... The following plasmids were used in this study: FLAG tagged ORFs in pcDNA3.1+/C-(K)DYK were purchased from Genscript: CDK1 (NM_001786.5) ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Microbiology 2024Quote: A DNA fragment encoding ELC07 Fab heavy chain with a C-terminal hexahistidine (His6) tag and subcloned into pcDNA3.1 was generated by GenScript. The constructs used for expression of stabilised trimeric HIV-1 Env (BG505 SOSIP.664 ...
-
bioRxiv - Immunology 2022Quote: ... total splenocytes were seeded at 0.5×106 cells per well in a 24-well plate and stimulated with 0.1 μM OVA257-264 (Genscript RP10611) peptide and 20 ng/ml recombinant murine interleukin-2 (IL-2 ...
-
bioRxiv - Immunology 2022Quote: ... 2 × 106 splenocytes from each animal were transferred in a round bottom 96 well plate (200 µl volume) and ex vivo restimulated with 1 µg/ml of the lmon_0149 peptides YSYKFIRV (GenScript) and QVFEGLYTL (made in house by solid phase synthesis ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biophysics 2022Quote: ... which was synthesized with an N-terminal fluorescein label (5-FAM, GenScript USA Inc. Piscataway, NJ). Fluorescence polarization measurements were carried out in black 96-well plates measured on a Wallac Victor 2 Plate Reader (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2020Quote: NR peptide was synthesized with a N-terminal 5-FAM modification by GenScript (Piscataway, NJ, USA). Hsp70 was titrated in triplicate while the NR-peptide concentration remained constant at 20nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were boiled for 5 minutes with 100 mM DTT and 1X LDS buffer (GenScript M00676) and run on NuPAGE 4-12% Bis-Tris gels (Thermo NP0335BOX ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Biochemistry 2023Quote: ... A forward ssRNA oligonucleotide labeled with Carboxyfluorescein (FAM) at the 5’ end was synthesized by GenScript Co. ...
-
bioRxiv - Biochemistry 2023Quote: ... XM_003200755.5), medaka fish (MeMfsd7c, XM_004082328.4), and frog Mfsd7c (XeMfsd7c, NM_001016982.2) coding sequences were synthesized by GenScript and cloned into pcDNA3.1 plasmid for overexpression ...
-
bioRxiv - Cell Biology 2024Quote: ... Drosophila Genetic Research Center) with a synthetic DNA sequence corresponding to the missing 5’ sequence (GenScript). The cDNA corresponding to the mCherry sequence was ligated to the 3’ end of the rdgC cDNA after the removal of the stop codon ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: The human FOXA1 sequence with RefSeq accession ID NM_004496 was synthesized with a C-terminal V5-tag sequence and obtained in pCIneo vector with NheI and XhoI cloning sites from GenScript. The sequence with the C-terminal V5-tag was transferred to the pEF1neo mammalian expression vector using NheI and SalI ...
-
bioRxiv - Immunology 2021Quote: ... 1×105 PBMCs were plated per well in triplicate with a single overlapping peptide pool spanning spike from the N to C terminus (GenScript, 15 amino acid length ...
-
bioRxiv - Genetics 2021Quote: ... This construct with a C-terminal 3x HA epitope tag was generated and subcloned into pUASTattB by Genscript (NJ, USA). Transgenic flies were generated by Genetivision (Houston ...
-
bioRxiv - Microbiology 2020Quote: ... as well as two mutants TANV16L (K52A and R90A) lacking 23 C-terminal residues were cloned into the bacterial expression vector pGex-6p-1 (Genscript). Recombinant TANV16L was expressed in C41(DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: Commercial synthetic Ste18Nt peptides were synthesized with N-terminal acetylation and C-terminal amidation and various combinations of S3 and S7 phosphorylation (or non-phosphorylated) and enriched to 95% purity (Genscript). Lyophilized peptides were reconstituted in deionized water at a concentration of 2.5 mg/ml and further diluted as necessary with 10mM potassium phosphate buffer (pH 7) ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then heated for 5 minutes at 85°C and separated by SDS-PAGE and analyzed by Western blot using rabbit anti-GST antibody (Genscript), rabbit α-RSV CA ...
-
bioRxiv - Microbiology 2019Quote: Mammalian expression plasmids (pcDNA3.1+/C-(K)DYK) for HLA-DRA (NM_019111) and HLA-DRB1 (NM_001243965) were purchased from GenScript (Piscataway, NJ; USA). HEK293T/17 cells at sub-confluence in 6-well plates or 100 mm dishes were transfected with HLA-DRA plasmid or HLA-DRB1 plasmid or a 1:1 combination of both using the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2019Quote: ... the cDNAs of hGlyT1b in eGFP-C-1 and hGlyT2b in pcDNA3.1(+)-N-eGFP were bought from Genscript (NY, USA). The transfection was performed with jetPRIME® (0.8 µg DNA/dish ...
-
bioRxiv - Microbiology 2019Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Bioengineering 2020Quote: DexVS gels were formed via a thiol-ene click reaction at 3.3% w/v (pH 7.4, 37°C, 45 min) with VPMS crosslinker (12.5, 20, 27.5 mM) (GCRDVPMSMRGGDRCG, Genscript, George Town, KY) in the presence of varying amounts of argininylglycylaspartic acid (RGD ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 St containing 2X-StrepTag at the C-terminal region was commercially synthesized as mentioned above (GenScript Biotech). SARS-CoV-2 N ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were dried down under a stream of nitrogen at 42°C and treated with recombinant ceramide glycanase (rEGCase; GenScript) to release ceramide-linked glucosylceramide derived GSL oligosaccharides ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Cell Biology 2021Quote: ... The base Scarlet I-pDM304 expression plasmid for C-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized Scarlet I gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... linker with both N-terminal and C-terminal 10×His-tags with a cysteine adjacent to each 10×His tag in a pET21b vector (Genscript). The plasmid was transformed into T7 express cells (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression plasmid containing a C-terminal 3Xflag tagged BioID2 sequence with a 198bp (13X “GGGGS” repeat) linker sequence upstream of BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Neuroscience 2022Quote: Gja1 overexpression in ANS4-GFP was performed using a pcDNA3.1+ /C-(K)DYK vector containing mus musculus Gja1 (Cx43) cDNA (GenScript NM_010288.3). Transfection was performed according to the manufacturer’s experimental protocol in 6-well plate ...
-
bioRxiv - Biochemistry 2022Quote: ... four copies of inhibitory peptide or control peptide with mutated binding motif spaced out by a flexible GST linker and fused to C-terminus of EGFP were ordered from GenScript. At 72 h post transfection ...
-
bioRxiv - Microbiology 2020Quote: The I53-50B.4PT1 was codon-optimized and synthesized and then cloned into a modified pET28a* vector with a C-terminal hexahistidine tag by Genscript.
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: The coding sequences for the extraviral domain of VARV A33 with N terminus 6×His tag and C-terminus Avi-tag were synthesized by GenScript and directly cloned into the PET-28a(+) ...
-
bioRxiv - Biochemistry 2022Quote: ... synthesized and subcloned into the pET28a(+) vector with restriction cleavage by NdeI/XhoI to carry both N- and C-terminal His6 tags (Genscript). Primers carrying a G155A or G225V mutation were designed for site-directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... a gene SIRT7 (C-terminally 3xFLAG tagged) under the control of a CMV promoter in pcDNA3.1 was commercially synthesized (GenScript, USA). For transfection experiments ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The SARS-CoV-2 sp12 gene was codon optimized and cloned into pFastBac with C-terminal additions of a TEV site and strep tag (Genscript). The pFastBac plasmid and DH10Bac E ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized cDNA encoding the SARS-CoV-2 S1 domain fused to the C-terminal portion of the VSV glycoprotein was obtained from Genscript. The cDNA was cloned into the XhoI and NheI sites of a modified recombinant VSV vector containing an additional transcription start stop signal between the G and L genes (Wirblich et al. ...
-
bioRxiv - Microbiology 2019Quote: ... the 18-CSP was synthesized using methoxy-coumarin-acetic-acidyl (MCA) on the N-terminal and Lys-Dinitrophenyl on the C-terminal (Dnp) (MCA-SGSLSTFFRLFNRSFTQA-Dnp; GenScript).