Labshake search
Citations for GenScript :
301 - 350 of 806 citations for Mouse Alpha 1 antitrypsin 1 3 SERPINA1C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-RHDV RdRp was prepared by Genscript and stored in our laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA of mouse Tia1 was purchased from GenScript in pcDNA3.1 vectors (clone ID ...
-
bioRxiv - Microbiology 2019Quote: ... mouse and rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Genetics 2021Quote: ... We followed up with Mouse anti His6 (Genscript), rabbit anti-HA-PE (Cell Signaling Technology) ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse PANX1 (UniprotID: Q9JIP4) was synthesized by GenScript and subcloned into the pEGC Bacmam vector(41) ...
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Immunology 2019Quote: ... was added to wells either alone or with CGRP (1, 10, 100 nM, GenScript) and incubated for 72 hr ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Flag-tag specific mouse antibody (Genscript, catalog no: A100187) and HA-tag specific rabbit antibody (Cell Signaling ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Clorf109 monoclonal antibody was purchased from Genscript company (Nanjing ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-FLAG was from Genscript (Nanjing, Jiangsu). FITC-conjugated goat anti-mouse ...
-
bioRxiv - Cancer Biology 2022Quote: The open reading frame of mouse GPx2 (GenScript NM_030677.2) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: Recombinant mouse interleukin-11 (rmIL11) (Z03052, Genscript, Oxford, UK) was dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... The mouse Tmem63b gene (NM_198167) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Bioengineering 2021Quote: The 14 designs chosen for experimental tests from PIP version 1 were ordered from GenScript pre-cloned into the pET-21a expression vector ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Biochemistry 2021Quote: ... the codon-optimized WP_011499504.1 ORF was subcloned into pGEX-4T-1-H expression vector (Genscript) to create pGEX4T1_ WP011499504 ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following antibodies were used in this study: anti-myc (1:1000 Genscript A00173-100), anti-Rad53 (1:1000 Abcam ab104232) ...