Labshake search
Citations for GenScript :
251 - 300 of 806 citations for Mouse Alpha 1 antitrypsin 1 3 SERPINA1C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Microbiology 2023Quote: ... 0.6 mg/mL mouse anti-FimH (Sokurenko (mouse samples) or custom antibody produced by Genscript (bacterial samples), 0.1 mg/mL anti-GroEL (Enzo) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µg/ml rabbit anti-chick MMP13 custom-made primary antibody (GenScript, Piscataway ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tartan (Rabbit, 1:100, This study, GenScript, based on Full-length peptide). Donkey and Goat secondary antibodies conjugated to AlexaFluor488 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1:200 rabbit anti-S tag (Genscript A00625) overnight and 1:1000 mouse anti GFP (Thermo Fisher A-11120 ...
-
bioRxiv - Microbiology 2019Quote: ... A codon-optimized version of RVB Bang117 NSP1-1 was synthesized (Genscript) and cloned into pLIC8 and pLIC6 using ligation-independent cloning following PCR amplification with appropriate primers and T4 DNA polymerase treatment ...
-
bioRxiv - Plant Biology 2019Quote: Polyclonal antibodies against Peptide-1 was raised in rabbit (GenScript, NJ, USA). Crude proteins from root tissues ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Biochemistry 2022Quote: ... α-actinin-1 and myotilin derived peptides were obtained from Genscript (USA). For immunofluorescence imaging we used goat anti-human VPS35 (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... were coated with S-2P protein 1 μg/mL (Genscript, Piscataway, NJ), RBD protein 1 μg/mL (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Neuroscience 2023Quote: The spike peptides (Table 1) were custom ordered and synthesized by Genscript, Netherlands as previously described in Nyström et al 2022 (20) ...
-
bioRxiv - Biochemistry 2023Quote: ... gene blocks containing A5 fused with alternative purification tags (Genscript; Table 1) were inserted via standard cloning techniques and digested with NcoI and NotI (NEB ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biochemistry 2022Quote: ... DARPins were detected with rabbit anti-FLAG antibody (GenScript, A01868; 1:5,000) and goat anti-rabbit-AP antibody (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... pET-28a-6xHis-TEV-3xFLAG-ATP6V1H(1-351) was purchased commercially (GenScript). pFBDM-ATG7-ATG10-ATG12-StrepII2x-ATG5-ATG16L1 and pFDM-SH-SUMO*-Hrr25 were described previously (Schreiber et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using an anti-Histidine-tag primary antibody (Genscript A00186; 1:3000 dilution) and an IR800 conjugated secondary antibody (Li-Cor Biosciences) ...
-
bioRxiv - Molecular Biology 2024Quote: ... One membrane was incubated with the anti-transthyretin antibody (1:1,000; Genscript) in 5 % milk overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... the membrane was incubated with an anti-transthyretin antibody (1:1,000; Genscript) overnight in 5% milk in TBS-T ...
-
bioRxiv - Microbiology 2024Quote: ... anti-PicA (dilution = 1:1,000; custom polyclonal rabbit antibody generated by GenScript), and anti-RpoB-HRP (loading control ...
-
bioRxiv - Microbiology 2024Quote: ... anti-EBV BALF0/1 rabbit mAb (generated by Genscript for this study), anti-EBV ZEBRA Mouse mAb (BZ1 ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Cell Biology 2020Quote: We obtained mouse TMEM16K cDNA from Genscript (Clone ID ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Plant Biology 2022Quote: ... mouse anti-Flag (A00187, GenScript, Piscataway, NJ), rabbit anti-histone H3 (A01502 ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Genetics 2023Quote: ... A plasmid containing mouse Pax1 (GenScript; OMu21524) was used as template for DIG-labeled probes ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Developmental Biology 2020Quote: vash-1 full length cDNA (EMSEMBL ENSDART00000143819.3) was designed and synthesised by GenScript. TA overhangs were added by incubating the insert for 10 min at 72 °C with 50mM DNTPs and Taq polymerase (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... rabbit anti-OLLAS tag pre-absorbed against untagged animals 1:150 (Genscript, #A01658), mouse anti-FLAG pre-absorbed against untagged animals 1:400 (Sigma, ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 120 peptides (Table 1) were produced by Genscript (Piscataway, NJ). Upon receipt ...
-
bioRxiv - Bioengineering 2022Quote: ... Peptides for zinpyr-1 competition binding assay were synthesized by GenScript (Piscataway, NJ). Reagents for making competent E.coli cells were obtained from Zymo Research (Irvine ...
-
bioRxiv - Bioengineering 2022Quote: The following primary antibodies were used: goat anti-HA (1:250; GenScript, A00168), rabbit anti-HA (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... and 500 μL of tissue culture media containing 500 pM GLP-1 (GenScript) added to the lower chamber ...
-
bioRxiv - Immunology 2019Quote: ... NY-ESO-1 (157-165; SLLMWITQV) peptide was purchased at >95% purity (GenScript). Purified peptide-HLA-A*02 was biotinylated in vitro by BirA enzyme (Avidity ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...