Labshake search
Citations for GenScript :
251 - 300 of 609 citations for CD366 Tim 3 Antibody APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of METTL8 in stably-infected cell lines were characterized by immunoblotting with the anti-Strep antibody (THETM NWSHPQFEK antibody, Genscript, cat. No. A01732, 1:1000 dilution). Transient transfections of TWIN-Strep and FLAG-tagged proteins were also loaded onto BOLT 4–12% Bis-Tris gels ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
bioRxiv - Plant Biology 2020Quote: Custom affinity-purified polyclonal anti-UCC1 antibodies were produced by Genscript, USA and were used as a primary antibody ...
-
bioRxiv - Microbiology 2020Quote: ... Custom primary peptide antibody generated in rabbits against ICP1 capsid (GenScript) was diluted 1:1500 and applied to the membrane for more than three hours ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... VHH-huFc antibodies identified from screening were commercially obtained from GenScript.
-
bioRxiv - Genomics 2021Quote: ... The following antibodies were used: Gcn5 (rabbit polyclonal, 1:1000, (GenScript antibody services ...
-
bioRxiv - Biochemistry 2022Quote: ... All primary antibodies were tailor-made by GenScript (New Jersey, USA) with sequences found in Supplementary Table 7.
-
bioRxiv - Plant Biology 2022Quote: ... and used it to raise a polyclonal antibody in rabbit (Genscript). Anti-AtSMC3 and anti-GFP (Roche 11814460001 ...
-
bioRxiv - Microbiology 2023Quote: ... Biotinylated anti-VHH monoRab monoclonal antibody (Genscript, catalogue number A01995-200) was captured at a concentration of 0.1 μg/mL (10 ng/well in 0.1 mL ...
-
bioRxiv - Biochemistry 2023Quote: ... a rabbit anti-Strep-tag IgG antibody (Genscript, Piscataway, NJ, USA) and a goat anti-rabbit IgG Alexa 488 conjugate as secondary antibody were used ...
-
bioRxiv - Cell Biology 2023Quote: The anti-phospho BRCA1 antibody was raised and purified by GenScript against phosphorylated peptide CQSESQGVGL{pSer}DKEL.
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were anti-strep tag (GenScript, A01732, 1/1000), anti-PHF21A (in house ...
-
bioRxiv - Microbiology 2024Quote: ... The anti-His antibody was obtained from (Genscript, catalog number A00186).
-
bioRxiv - Microbiology 2024Quote: ... The anti-strep (#A00626) antibody was purchased from GenScript (Nanjing, China). The anti-MAVS (#sc-166583 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was incubated with FLAG-antibody-coated beads (Genscript, L00432) and washed with wash buffer (50 mM HEPES/NaOH ...
-
bioRxiv - Biochemistry 2024Quote: The custom-produced rabbit anti-RDD antibody was ordered from Genscript INC as described in our previous work [9].
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µg/ml rabbit anti-chick MMP13 custom-made primary antibody (GenScript, Piscataway ...
-
Molecular structure and conformation of stereocilia tip-links elucidated by cryo-electron tomographybioRxiv - Neuroscience 2021Quote: Rabbit polyclonal and monoclonal antibodies were generated using standard techniques by Genscript using the soluble PCDH15 EC1-EL extracellular region as the antigen ...
-
bioRxiv - Genomics 2020Quote: ... An antibody to CENH3 was custom-produced by GenScript (Piscataway, NJ, USA) against a peptide designed based on the C ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies (anti-FLAG M2; Sigma and chimeric ACE2-Fc (Genscript; Z03484) were diluted in PBS-BSA to 1 μg mL−1 and added to each imaging dish ...
-
bioRxiv - Bioengineering 2021Quote: Monoclonal antibodies against GAA and GILT-tag sequence were generated by Genscript. Mouse plasma samples were screened for the presence of GAA protein using JessTM ProteinSimple and following manufacturer’s protocol (ProteinSimple ...
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
A gut-secreted peptide controls arousability through modulation of dopaminergic neurons in the brainbioRxiv - Neuroscience 2020Quote: Rabbit anti-CCHa1 antibodies were raised against the peptide QIDADNENYSGYELT21 by Genscript and affinity purified by the company.
-
bioRxiv - Microbiology 2022Quote: ... The polyclonal antibody against CrPV-1A in rabbits was generated by Genscript. USA.
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...