Labshake search
Citations for GenScript :
201 - 250 of 609 citations for CD366 Tim 3 Antibody APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-PknG antibody was produced and purified by GenScript Biotechnology with the recombinant GST-tagged PknG protein as immunogen (1/10000 for immunoblotting ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Microbiology 2020Quote: A custom polyclonal anti-KH antibody was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...
-
bioRxiv - Evolutionary Biology 2024Quote: A custom anti-VGLL3 polyclonal antibody was procured from Genscript with delivery in January 2020 as follows ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... and anti-Cas9 antibody (Clone 4A1) were purchased from Genscript. All DNA oligos were purchased from Integrated DNA Technologies ...
-
bioRxiv - Immunology 2023Quote: ... THETM V5 Tag antibody (both at 1:5000 dilution, GenScript), and CLIPA8 primary antibody (1:5000 dilution ...
-
bioRxiv - Evolutionary Biology 2024Quote: The rabbit antibody for Shavenbaby (Svb) was produced by GenScript against the following amino acid sequence:
-
bioRxiv - Molecular Biology 2023Quote: The polyclonal primary antibody anti-Orco was purchased from Genscript and designed against the peptide sequence SSIPVEIPRLPIKSFYPW in the second extracellular loop (ECL2) ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 dilution overnight at 4 °C with gentle rocking ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 were used ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy and light chain genes were synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Developmental Biology 2023Quote: Anti-Miranda polyclonal antibody was generated by Genscript (https://www.genscript.com/). The epitope used for immunization is ...
-
bioRxiv - Neuroscience 2024Quote: Mouse monoclonal tau antibody 8B2 IgG1κ was generated by GenScript as previously described by immunizing BALB/c mice with a peptide encompassing to pSer396/404 region of the tau protein that was conjugated to keyhole limpet hemocyanin via a cysteine residue (cTDHGAEIVYK(pS)PVVSGDT(pS)PRHL ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Immunology 2024Quote: ... Incubation with the primary antibody (rabbit anti-CxVLG-1 (GenScript) generated in [26] ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were probed with custom-made anti-Hcp antibodies (GenScript; polyclonal antibodies raised in rabbits against the peptide DPQSGQPAGQRVHKC) ...
-
bioRxiv - Plant Biology 2024Quote: ... All custom antibodies were produced by GenScript (Piscataway, NJ, USA). Secondary detection used a fluorescent goat anti-rabbit antibody (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273).
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...