Labshake search
Citations for GenScript :
251 - 300 of 811 citations for 4 Triethylsilyl 3 butyn 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we constructed HDR plasmids with the egfp-chimeric hiphop-PBacDsRed cassette flanked with one kilobase homology arms 5’ and 3’ of their respective guide RNAs into pUC57-Kan (GenScript, Piscataway, NJ). The cassette consists of the 3xP3-DsRed visible marker (66 ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (nominally 50 μg) from each sample were separated on 4-20% gradient Bis-Tris SDS-PAGE gels (GenScript), and protein was then electroblotted onto low autofluorescence PVDF membrane (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... Monomeric αSyn and αSyn oligomers were then resolved by SDS-Page into a gradient 4-20% SDS-Page gel (GenScript) and transferred to polyvinylidenedifluoride (PVDF ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
The activator domain of bacterial collagenases drives collagen recognition, unwinding and processingbioRxiv - Biochemistry 2023Quote: The coding sequences of V-B from Scl2.28 incorporating the 4 mutated tripeptides and the coding sequence of the V domain from Scl2.3 were purchased from Genscript (Germany). The modified coding sequence of V-B was cloned into a modified pET15b vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Immunology 2024Quote: ... Gametocyte extract and 230CMB 21 samples were mixed with 4× NuPAGE™ LDS sample buffer and heated for 10 minutes at 70°C before loading on a 4–20% Bis-Tris gel (GenScript). 20 ng 230CMB was loaded per well and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... with pGS-CMAS-Neo plasmid with sgRNA targeting exon 4 of CMAS with CCATCCCAGTCTTGTCGACG gRNA from a U6 promoter and a neomycin-resistance marker (GenScript). Clonal A549 CMAS-deficient cell lines were established by limiting dilution after selection with 800 μg/mL G418 (GeneticinTM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... 1 (Genscript Biotech). Additionally ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... An equivalent amount of total proteins was loaded in each lane and resolved on a 15% SDS-PAGE gel or 4-12% SurePAGE™ Bis-Tris gel (Genscript), transferred to nitrocellulose by electroblotting ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...