Labshake search
Citations for GenScript :
201 - 250 of 811 citations for 4 Triethylsilyl 3 butyn 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Neuroscience 2024Quote: ... Equal amounts of 10 μg protein lysate were loaded and separated on a 4-12% SurePAGETM gel (GenScript) and transferred to a polyvinylidene difluoride membrane (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by denaturation at 95°C for 10 min and loading on 4-20% ExpressPlusTM PAGE gels (GenScript). The gel was allowed to run at 120V for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... the samples were cooled and loaded onto a SurePAGE Bis-Tris 4-12% gel (GenScript, Piscataway, NJ, USA) with Protein Precision Plus dual color ladder (Bio-Rad laboratories ...
-
bioRxiv - Immunology 2024Quote: ... heated at 70°C for 10 min before loading on a 4-20% bis-tris polyacrylamide gel (GenScript). In the case of purified protein 1 μg protein was loaded per condition and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 1 µL of 1 µM crRNA (GenScript, custom) and 1 µL of 280 mM MgOAc (TwistDx) ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was quenched by SDS sample buffer and analyzed by 4-20% SDS-gel (GenScript, Piscataway, NJ, US). Fluorescent ubiquitin signals were imaged using Thermo iBright exposed for 750 ms.
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were recovered and 20 μg protein were separated on SurePAGE Bis-Tris 4-12% gradient gel following the manufacturer’s instructions (Genscript). A protein standards ladder (BioRad #1610374 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Biochemistry 2024Quote: Codon-optimized RdRp and VPg genes of HuNoV GII.4 Sydney strain (GenBank: AFV08794.1) were synthesized and cloned in the pET28a vector for bacterial expression by Genscript U.S.A ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Microbiology 2024Quote: Supernatants and eluted samples were run on 4-12% SurePAGE™ Bis-Tris Gels (M00652, M00653, or M00654, GenScript), followed by wet transfer to Immobilon-P polyvinylidene difluoride (PVDF ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant obtained after centrifugation of lysate for 20 min at 10,000 rpm at 4°C was loaded onto anti-DYKDDDDK G1 affinity resin (GenScript) equilibrated with buffer A ...
-
bioRxiv - Biochemistry 2024Quote: ... (NM_005855.4, H-pSL056), RAMP2 (NM_005854.3, H-pSL042) and RAMP3 (NM_005856.3, H-pSL043) were purchased from Genscript (Piscataway, NJ, USA). The DNA construct of the calcitonin receptor C-terminally fused with NanoLuc luciferase [22] (Nluc_FL_CTR (H-pSL054) ...
-
bioRxiv - Cell Biology 2024Quote: ... UK). AFF3ir-ORF2 (Cat. No. C0302HL300-4) and AFF3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (NJ, USA). GAPDH (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...