Labshake search
Citations for GenScript :
2501 - 2550 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were immunoblotted with α-FLAG (GenScript) followed by HRP-conjugated α-mouse antibodies (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Immunology 2022Quote: ... total splenocytes were seeded at 0.5×106 cells per well in a 24-well plate and stimulated with 0.1 μM OVA257-264 (Genscript RP10611) peptide and 20 ng/ml recombinant murine interleukin-2 (IL-2 ...
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Bombyx mori CPES (XM_004923146.3) were codon optimized and synthesized by GenScript® and subcloned into pUAST vector ...
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Cancer Biology 2022Quote: ... were obtained from Genscript for expression in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sepharose beads were then eluted with 0.5 mg/ml c-Myc peptide (Genscript) in TBS ...
-
bioRxiv - Molecular Biology 2022Quote: Peptide P87 (LNTFVRFIKINPAIHKALKSKNWAEFAKR) was synthesized and provided by GenScript as a freeze-dried powder ...
-
bioRxiv - Molecular Biology 2022Quote: ... the supernatant was loaded onto a column with 1mL Anti-DYKDDDDK G1 Affinity Resin (GenScript) and the 1×FLag-tagged proteins were affinity extracted ...
-
bioRxiv - Molecular Biology 2022Quote: ... The coding sequences of human UBXN1 (Uniprot identifier Q04323-1) and FAF2 (Uniprot identifier Q96CS3-1) were synthesized by GenScript Biotech ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... such as scrambled sequences (using the Genscript random library tool ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... and Shisa7 (NM_001145176.2; pIRES2-EGFP) plasmids were generated by Genscript (GenScript, Piscataway, NJ). pIRES2-EGFP vector was a gift from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... plasmids were generated by Genscript (GenScript, Piscataway, NJ). pIRES2-EGFP vector was a gift from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids containing the N171 N-terminal fragment sequence of human HTT bearing either 85 CAG repeats (HTT85Q, pathological HTT fragment) or 10 CAG repeats (HTT10Q, control HTT fragment) were manufactured by GenScript and subsequently cloned into a transgene cassette flanked by viral inverted terminal repeats (ITRs) ...
-
bioRxiv - Immunology 2022Quote: ... with virus from LVX-PD1-mNeonGreen lentiviral vector (synthesized by GenScript) and cultured in RPMI1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... with virus from pLVX-PDL1-mScarlet lentiviral vector (synthesized by GenScript) and cultured in F12 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: Plasmids encoding cDNAs of Pneumovirus proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector (30 ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-V5 (Genscript); 2 ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-FLAG (Genscript); 4 ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Immunology 2022Quote: ... the following pairs of primary antibodies were used: 1) TCRα-TCRβ crosslinking: rabbit anti-c-Myc (Genscript) and mouse anti-V5 (Genscript) ...
-
bioRxiv - Immunology 2022Quote: ... The TCR variable region in combination with mouse TCR α and β constant regions was then obtained as synthetic DNA (GenScript) that was subcloned into the pMIG II vector and used for transduction36.
-
bioRxiv - Immunology 2022Quote: ... and incubated at 37°C with different concentrations (10 μM, 2.5 μM and 0.0625 μM) of synthetic peptides (GenScript) or chymotrypsin-digested gluten (100 μg/ml ...
-
bioRxiv - Immunology 2022Quote: BCR binding to gluten peptides was assessed using tetramerized synthetic peptides (obtained from GenScript or GL Biochem) containing an N-terminal biotin moiety and a GSGSGS linker ...
-
bioRxiv - Immunology 2022Quote: ... The sequence of human IL-18BP (residues 1-194, UniProt ID: O95998) was purchased in the pUC57 vector at GenScript (GenScript, Piscataway, New Jersey, USA). The sequence was cloned in frame with a C-terminal caspase3 site followed by an AviTag and a His6 tag ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... coli and purchased in the pUC57 vector from GenScript (GenScript, Piscataway, New Jersey, USA). The sequence was cloned into the pET42a plasmid (Cat No 70561 ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant DNA was purchased from GenScript (GenScript, Piscataway, New Jersey, USA). The mature sequence of human IL-18 (residues 37-193 ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... or were created by spike gene synthesized by GenScript using the spike sequence in VRC7480 as template ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant DNA was purchased from GenScript (GenScript ...
-
bioRxiv - Immunology 2022Quote: ... coli and purchased in the pUC57 vector from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Microbiology 2022Quote: ... in Tris-MOPS-SDS running buffer (Genscript), and proteins were transferred to PVDF membrane ...
-
bioRxiv - Immunology 2022Quote: ... The variant RDB sequences including flanking regions and convenient restriction enzyme sites were synthesized (Genscript Biotech, Piscataway, NJ) and cloned into the SSWE gene using restriction enzymes BsrGI which cuts at base pair 1104 and Age1 of the SB1.351 sequence and BseGI and NheI ...
-
bioRxiv - Plant Biology 2022Quote: ... The membrane was first stained with Ponceau S to show protein loading before blocking and incubation with first antibodies: CHLI antiserum was raised by Genscript (Nanjing, China) and validated in chli mutant and WT (Supplemental Figure S12) ...
-
bioRxiv - Plant Biology 2022Quote: ... a DNA fragment containing two expression cassettes was synthesized artificially (GenScript, China): one was for the plasma-membrane-targeted mTagBFP2-FRB and the other was for the ICR1- or ICR2-fused mCherry-FKBP12 (Fig ...
-
bioRxiv - Plant Biology 2022Quote: ... the gels were firstly analyzed through immunoblotting with anti-PDR6 antibody (prepared with peptide CTVVEEGKDKHKGSH as antigen by GenScript, China) and a horseradish peroxidase-conjugated antirabbit IgG secondary antibody (Beyotime Biotechnology ...