Labshake search
Citations for GenScript :
2751 - 2800 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Neuroscience 2022Quote: ... Wildtype CDK6 and CDK6pA197T cDNA was cloned into pCIG3 by GenScript. FLAG-tagged wildtype CDK6 and CDK6pA197T cDNA was cloned into in pcDNA3.1 by GenScript.
-
bioRxiv - Molecular Biology 2022Quote: 60 Human ORF clones were purchased from GenScript (https://www.genscript.com) for the Wnt pathway (Table S1) ...
-
bioRxiv - Neuroscience 2022Quote: ... FLAG-tagged wildtype CDK6 and CDK6pA197T cDNA was cloned into in pcDNA3.1 by GenScript.
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sam68 C-terminal cDNA was synthetized with optimized codon composition for bacterial expression (Genscript).
-
bioRxiv - Neuroscience 2022Quote: ... 220 kDa ankyrin-B F131Q/F164Q (Wang et al., 2014) was created by Genscript by site-directed mutagenesis ...
-
bioRxiv - Neuroscience 2022Quote: Human NaV1.2-3xFLAG IRES eGFP was generated by Genscript (Piscataway, NJ) by the addition of a short linker (AAARG ...
-
bioRxiv - Neuroscience 2022Quote: ... Δ9 NaV1.2-3xFLAG IRES eGFP was created by Genscript by deletion of the necessary nine amino acid core ankyrin-binding motif ...
-
bioRxiv - Microbiology 2022Quote: ... whereby a 100-bp antisense RNA synthesized by Genscript, spanning 50-bp upstream and downstream of nimB from the start codon ...
-
bioRxiv - Microbiology 2022Quote: ... a 1000 bp cassette of the upstream and downstream flanking regions were synthesized by Genscript, cloned into pMTL-SC7215-CD2517.1 and conjugated into R20291 ...
-
bioRxiv - Microbiology 2022Quote: ... whereby the guide RNA targeting nimB was synthesized by Genscript and cloned into the PmeI site of vector pXWxyl-dcas9 ...
-
bioRxiv - Biochemistry 2022Quote: ... LEALEFQ were synthesised by GenScript and dissolved in DMSO to 50 mM and stored at -80 °C
-
bioRxiv - Cancer Biology 2022Quote: ... The full-length TRB and TRA chains were cloned separated by a furin SGSG P2A linker into pMSGV1 retroviral vector (GenScript). Transient retroviral supernatants were generated by transfecting the vector encoding the TCR of interest (MSGV1 ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Cell Biology 2022Quote: ... Pink1 sgRNAs were designed and cloned to pGS plasmid (Genscript, #1 GCTGGTCCCGGCAAGCCGCG ...
-
bioRxiv - Genetics 2022Quote: ... potentially due to their age. We additionally attempted to raise new antibodies using the previously published epitopes (Bickel et al. 2010) (synthesized by GenScript) in chickens (SMC-5 ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Genetics 2022Quote: The pancreatic isoform of human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast expression and cloned into pDONR221 (Genscript). The initial test set GCK variants were generated by Genscript ...
-
bioRxiv - Genetics 2022Quote: ... Human GKRP (Ensembl ENST00000264717.7) was codon optimized for yeast expression and cloned into pDONR221 with an N-terminal HA-tag (Genscript). For yeast expression ...
-
bioRxiv - Genetics 2022Quote: ... The initial test set GCK variants were generated by Genscript. For yeast expression ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were incubated on a rotator for 1 h at room temperature and then incubated with 15 μL of a 25% slurry of nickel-charged MagBeads (Genscript) for an additional 1 h on the rotator at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The pcDNA3-SARS-CoV-2-Spike plasmid contains a codon- optimized ORF for Spike from GenBank NC_045512 that was synthesized by GenScript (a kind gift from David Kelvin) then cloned between the KpnI and BamHI sites of pcDNA3.1(+) ...
-
bioRxiv - Microbiology 2022Quote: ... a synthetic DNA fragment (GenScript®) containing BAP tag in VP4 loops in amino acid regions 96-101 ...
-
bioRxiv - Microbiology 2022Quote: pPB-cytBirA was obtained from a synthetic DNA fragment (Genscript) containing the BirA enzyme open reading frame of Escherichia coli (UniProt accession number ...
-
bioRxiv - Microbiology 2022Quote: ... This synthetic DNA was cloned into the DIs vector plasmid pSMART-DIs-L3-GPTF (purchased from GenScript, Nanjing, China), which harbors the Escherichia coli gpt gene (encoding xanthine-guanine phosphoribosyltransferase ...
-
bioRxiv - Microbiology 2022Quote: ... and pangolin) with a C-terminal V5 tag were synthesized by GenScript as described previously 42 ...
-
bioRxiv - Microbiology 2022Quote: ... and (pink) were obtained by inserting a synthetic DNA fragment (Genscript) encoding for the VP4 protein-encoding BAP tag flanked by MfeI and NdeI restriction enzymes sites and ligated into those sites in the pT7-VP4-SA11.
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... The predicted defense systems were synthetized and cloned in the shuttle vector pSG1-RFP (between the AscI and NotI sites of the multiple cloning sites) by Genscript Corp ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids containing systems with these deletions/mutations were commercially synthesized by Genscript. The mutated systems were transformed into B ...
-
bioRxiv - Microbiology 2022Quote: Antibody production from the New Zealand rabbits followed the protocols approved by the Office of Laboratory Animal Welfare (OLAW) Assurance and the Institutional Animal Care and Use Committee (IACUC) of the vendor (GenScript, Piscataway, NJ).
-
bioRxiv - Microbiology 2022Quote: ... Peptides were commercially synthesized and biotin-labeled on the N-terminus using Fmoc chemistry (GenScript, Piscataway, NJ, USA). Sequences of these peptides are shown in Table 1.
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Neuroscience 2022Quote: Mouse voltage-gated sodium channel 5934 base pair-long genes (mSCN8AWT, mSCN8AK1425TAG, and mSCN8AK1546TAG were synthetized by GenScript (mSCN8A ...
-
bioRxiv - Neuroscience 2022Quote: ... Custom MHP_shRNA cassette was synthetized by GenScript so that human U6 promoter is directly followed by random sequence of 54bp flanked by HindIII and PacI restriction sites ...
-
bioRxiv - Pathology 2022Quote: ... The sgRNAs was packaged using a lentivirus library by GenScript, NanJing ...
-
bioRxiv - Neuroscience 2022Quote: ... XM:006510629.3 ORF sequence) cDNAs cloned into the pcDNA3.1+/C-(k)-DYK vectors were obtained from GenScript. For the electrophysiological recordings of the Na+ currents ...
-
bioRxiv - Microbiology 2022Quote: ... Polyclonal serum against Gn was raised commercially (GenScript) by immunisation of rabbits with a synthetic peptide (Gn residues 99–112 ...
-
bioRxiv - Evolutionary Biology 2022Quote: A pMAL-c4X-RecA plasmid was synthetized by GenScript (NJ, USA) using as a backbone the plasmid pMAL-c4X (Addgene #75288 ...
-
bioRxiv - Evolutionary Biology 2022Quote: All inserts were synthesized and cloned into the plasmids by GenScript (NJ, USA).
-
bioRxiv - Pathology 2022Quote: ... coli and synthesized by GenScript Corporation (Nanjing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were obtained from Genscript (Piscataway, NJ). Each peptide was dissolved to a concentration of 5 mg/mL in deionized water ...
-
bioRxiv - Systems Biology 2022Quote: ... and papC genes from Pseudomonas fluorescens were synthesized by GenScript (Piscataway, NJ). Primers and single-stranded oligonucleotides used for cloning and MAGE were synthesized by Integrated DNA Technologies (Coralville ...
-
bioRxiv - Systems Biology 2022Quote: ... coli using GeneSmart prediction software (Genscript). Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies ...
-
bioRxiv - Systems Biology 2022Quote: ... sapiens using GeneSmart (Genscript) and synthesized as gBlocks (Integrated DNA Technologies ...
-
bioRxiv - Systems Biology 2022Quote: ... we used CRISPR-mediated homology-directed repair with donor plasmid synthesized by Genscript. gRNA was designed using the target finder tool from flyCRISPR (https://flycrispr.org) ...
-
bioRxiv - Systems Biology 2022Quote: ... The construct was synthesized by Genscript and injected by BestGene Inc into D ...
-
bioRxiv - Immunology 2022Quote: ... then 3.5μL of 1 mg/ml normal mouse IgG (mIgG) (GenScript, Cat# A01007) was added ...
-
bioRxiv - Immunology 2022Quote: Peptides were purchased from GenScript (information available in Supplementary Table 4 ...