Labshake search
Citations for GenScript :
151 - 200 of 1364 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Immunology 2020Quote: ... concentrated and evaluated by SDS-PAGE using 4 –12% Bis–Tris Novex gels (GenScript catalog #M00652) under reducing and non-reducing conditions followed by a Coomassie blue staining (Expedeon ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μL of each sample was loaded in a 4-12% Bis-Tris SurePAGE gel (GenScript) using MOPS running buffer and then transferred onto a PVDF membrane (Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were loaded onto three independent SurePAGE Bis-Tris 10x8 4-12% gels (Genscript M00652) and run at 150 V for approximately one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were run on 4-12% ExpressPlus PAGE gels with Tris-MOPS-SDS running buffer (GenScript). Transfer was carried out in the cold room overnight in Tris-glycine buffer (250 mM Tris ...
-
bioRxiv - Developmental Biology 2023Quote: Immunoblot was performed according to a standard procedure using 4%-20% gradient SDS polyacrylamide gels (Genscript). Cells were directly lysed in 4X Laemmli gel loading buffer (Boston BioProducts) ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...
-
bioRxiv - Neuroscience 2024Quote: ... 30-50 μg of protein were loaded on or ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer or 7.5% ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were separated by SDS-PAGE using 4%-20% MOPS-acrylamide gels (GenScript Express Plus M42012) and transferred electrophoretically onto Immobilon PVDF membrane (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: Proteins were electrophoresed in a 4-20% SurePAGE gel and Tris-MOPS-SDS running buffer (GenScript). Proteins were transferred to a nitrocellulose membrane in wet conditions (25 mM Tris base ...
-
bioRxiv - Cancer Biology 2024Quote: ... to denature protein and loaded onto 4-12% GenScript SurePAGE™ Precast Gels (GenScript cat# M00653). The electrophoresis was run in Tris-MOPS-SDS running buffer (GenScript cat# M00138 ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded and separated on a 4-20% SDS–PAGE (GenScript, M42015C). The proteins were transferred to PVDF membrane (Cytiva ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-AQP4 (1:4000, GenScript Biotech, Piscataway, NJ, USA), rabbit polyclonal anti-AQP4ex (1:2000 ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed using 30 μ l of sample with 4-20% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... A total of 40 µg proteins were separated by 4-20% gradient SDS-PAGE gels (GenScript, M42015C) and transferred to PVDF membranes (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... and electrophoresed in 4-12% Express-Plus PAGE gels in Tris-MOPS (SDS) running buffer (GenScript #M00138). Proteins were transferred onto PVDF membranes ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Cell Biology 2024Quote: A total of about 75 ng of proteins were loaded on 4-20% acrylamide gels (GenScript, M00655) and run at 120 V for 90’ in commercial Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 kPa (5% 40 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), and 35 kPa (7% 20 kDa 8-arm PEG-NB ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Neuroscience 2024Quote: ... Equal amounts of 10 μg protein lysate were loaded and separated on a 4-12% SurePAGETM gel (GenScript) and transferred to a polyvinylidene difluoride membrane (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by denaturation at 95°C for 10 min and loading on 4-20% ExpressPlusTM PAGE gels (GenScript). The gel was allowed to run at 120V for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... the samples were cooled and loaded onto a SurePAGE Bis-Tris 4-12% gel (GenScript, Piscataway, NJ, USA) with Protein Precision Plus dual color ladder (Bio-Rad laboratories ...
-
bioRxiv - Immunology 2024Quote: ... heated at 70°C for 10 min before loading on a 4-20% bis-tris polyacrylamide gel (GenScript). In the case of purified protein 1 μg protein was loaded per condition and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Synthetic Biology 2022Quote: DNA chunks comprising ∼5-10 Kb of each megachunk were synthesized and sequence verified by Genscript (megachunks A-K and N-X), GeneArt (megachunks L ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...