Labshake search
Citations for GenScript :
451 - 500 of 1364 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: The sequence encoding the NSP3 ubiquitin-like domain 1 (Ubl1, residues 1-110) of SARS-CoV-2 was synthesized by Genscript Biotech and inserted into the pCMV-3Tag-3A plasmid ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Immunology 2021Quote: ... and S1 subunit (0.5 µg/mL) (cat n° Z03501, GenScript, Piscataway, NJ, USA) purified recombinant proteins dissolved in carbonate-bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were used to test activity in vitro against N- terminal peptides (Genscript) using 5,5-dithio-bis-(2-nitrobenzoic acid ...
-
bioRxiv - Biochemistry 2022Quote: ... FN3SH2 and h-Ras genes were synthesized by GenScript (Piscataway, NJ). cpFN3SUMO and cpFN3WDR5 genes were synthesized by Eurofins Genomics (Louisville ...
-
bioRxiv - Biochemistry 2022Quote: An endoglycosidase H (EndoH) gene from Streptomyces plicatus was synthesized (GenScript) for recombinant expression in E ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Biochemistry 2021Quote: The gene for N102LT N-terminally fused with tagRFP (gi: 336287738) was synthesised (GenScript) and inserted to unmodified pQlinkN plasmid using restriction enzyme cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Immunology 2024Quote: ... and N genes were integrated into a lentiviral expression plasmid (pGenlenti vector) from Genscript, UK ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides with N terminal acetylation and C terminal amidation were purchased from Genscript (Rijswijk, Netherlands). Peptides were dissolved in DMSO ...
-
bioRxiv - Immunology 2024Quote: The H-2Db-restricted peptide of LCMVGP33-41 (KAVYNFATM) was purchased from GenScript Biotech and dissolved in PBS supplemented with 0.5% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... V165A & R166A)50 and NL4.3(Δ: Δ(105 − 278)&Δ(301 − 332))44 in the HIV-1 proviral clone pNL4-3 were performed by GenScript. For use in electron microscopy ...
-
bioRxiv - Cell Biology 2020Quote: Sequences of full length hsRIPK2 with an N-terminal 3x-Flag tag were synthesized by Genscript and cloned into doxycycline-inducible lentiviral expression vectors (pF_TRE3G_rtTAAd_puro (Takara Bio)) ...
-
bioRxiv - Biochemistry 2020Quote: ... archaeon HeR gene (GenBank ID: KYK26602.1) containing an N-terminal histidine-tag was chemically synthesized (GenScript) and subcloned into the pET21a (+)-vector ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Microbiology 2024Quote: ... The recN and recA genes were cloned into pK(N)T25 and pUT18(C) vectors (GenScript) to create N– and C-terminal fusions with T25 and T18 fragments (Supplementary Table S1).
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...