Labshake search
Citations for GenScript :
101 - 150 of 631 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: Peptides were synthesized with C-terminal amidation (to reduce unwanted charge effects at the carboxy terminus) to generate wild-type and variants of the 17 N-terminal residues of CXCL12 (KPVSLSYRCPCRFFESH) (GenScript Biotech), a peptide known to elicit calcium mobilization and Gαi coupling signaling20 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments with wild type or mutation MTB DNA sequences were synthesized and cloned into pUC19 plasmid by GenScript (Figure 2). Concentrations of these plasmids are quantified by Bio-Rad ddPCR platform following the user guide ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Biophysics 2022Quote: Mutations were introduced by site-directed mutagenesis in the wild-type (WT) NQO1 cDNA cloned into the pET-15b vector (pET-15b-NQO1) by GenScript (Leiden, Netherlands). Mutated codons were optimized for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... featuring wild-type HttEx1 with 32 consecutive glutamine residues within the polyQ domain was sub-cloned into a pMALc5x plasmid by Genscript (Piscataway, NJ), as previously described (9) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... anti-cGMP antibody (PerkinElmer anti-cGMP antibody: final dilution1:8000, Genscript anti-cGMP antibody ...
-
bioRxiv - Immunology 2020Quote: ... Commercial antibodies tested also included a human IgG chimeric antibody from GenScript (SARS-CoV-2 spike S1 Antibody (HC2001), GenScript #A02038 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Microbiology 2023Quote: ... 0.874 mg/mL anti-FimH polyclonal antibody (custom antibody produced by Genscript) or 0.96 mg/mL anti-Muc2 (Novus) ...
-
bioRxiv - Genomics 2021Quote: ... H2A.X and H2A.Z antibodies are affinity-purified rabbit polyclonal antibodies made by GenScript USA Inc (Piscataway ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-pT25 OsMKK1 antibody (GenScript), anti-ACT1 antibody (Beijing Protein Innovation) ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-FLAG antibody (GenScript #A00187) was incubated in 10% FBS and 1xPBS for 1 h at 37°C at a concentration of 1μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... antibodies for α-Cis1a (GenScript) and α-Cis2 (GenScript ...
-
bioRxiv - Cell Biology 2023Quote: ... A rabbit polyclonal antibody (Genscript) produced against full-length Drosophila p23 (Q9VH95 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Anti-streptag purified antibody (Genscript) was also APC conjugated ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... The midguts were then incubated with primary antibody for liberibacter with anti-OmpB-antibody (GenScript), followed by secondary antibody conjugated with Cy3/Cy5 (Jackson ImmunoResearch Laboratories) ...
-
bioRxiv - Microbiology 2023Quote: ... was used to amplify signals from anti-FimH polyclonal antibody (custom antibody produced by Genscript). Slides were counterstained using 10 mg/mL bisBenzimide H 33258 dissolved in TBS for 20 minutes in the dark at room temperature then cover slipped ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Physiology 2019Quote: ... The primary antibody was prepared using a custom affinity-purified rabbit polyclonal antibody (Genscript, Piscataway, NJ) produced against Rhodnius prolixus RhoprCAPA-2 (EGGFISFPRV-NH2 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and Solanum lycopersicum flavanone 3-hydroxylase (SlF3H) were optimized and synthesized by GenScript (Nanjing, China). Genes encoding Yarrowia lipolytica pentafunctional arom protein (YlARO1) ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Microbiology 2022Quote: Antibody genes were synthesized by Genscript and recombinantly produced in a human IgG backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Purified antibody was produced by Genscript as human IgG in HD 293F mammalian cells ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... while the TAP antibody (Genscript, Inc) and the HA monoclonal antibody 2-2.2.14 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... This antibody was generated by GenScript, and is derived from the same peptide sequence used to elicit “3148” from the Nelson’s lab (46) ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Immunology 2023Quote: ... THETM DYKDDDDK tag antibody (A00188; Genscript) and Direct-BlotTM HRP anti-mCherry antibody (clone 8C5.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... antibody and a custom rabbit anti-NCX1 antibody as previously described5 (1:100, Genscript Corporation, Piscataway, NJ). Secondary antibody labeling was carried out using donkey anti-mouse Alexa Fluor 647 (1:200 ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...