Labshake search
Citations for GenScript :
51 - 100 of 631 citations for Proteasome Subunit Beta Type 3 PSMB3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Biochemistry 2021Quote: Wild-type USP14 and mutants were cloned into pGEX-4T vector obtained from GenScript (Nanjing, China). For purification of recombinant USP14 and mutants ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type OGG1 was expressed with a GST tag from a pGEX-6P1clone purchased from GenScript. The plasmid was transformed into T7 Express plysS Competent E ...
-
bioRxiv - Molecular Biology 2023Quote: The wild-type ASPA cDNA and selected variants studied in low throughput were generated by Genscript. The library cloning and barcoding described below are essentially as previously described 69 ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized human wild-type full-length (FL) APE1 in a pet28a vector was purchased from GenScript. The E96A/D210N ...
-
bioRxiv - Biophysics 2019Quote: Wild type rabbit skeletal regulatory light chain (RLC) insert (UniProtKB entry: MLRS_RABIT; P02608) was obtained from Genscript. Wild type chicken gizzard smooth muscle RLC (smRLC ...
-
bioRxiv - Immunology 2022Quote: The spike – S1 peptide pools of Wuhan wild-type SAR-CoV2 were purchased from Genscript (cat # RP30027). The Peptivator peptide pools for the variant of concerns and B ...
-
bioRxiv - Microbiology 2023Quote: The codon-optimized sequence coding for the wild type (WT) N (stain Long) was syn-thetised (GenScript) and cloned in the pFastBac Dual vector under the control of the polyhedrin promoter at BamHI and SalI sites ...
-
bioRxiv - Biochemistry 2023Quote: The cDNA of wild-type PRKN or PRKN variants studied in low-throughput were purchased from Genscript. Single PRKN variants were integrated into the Tet-on landing pad in the HEK 293T TetBxb1BFPiCasp9 Clone 12 cell line ...
-
bioRxiv - Biochemistry 2023Quote: ... GNAI1 with the same flanking restriction sites was amplified from a wild type clone (Genscript, clone OHu13586) and from a designed codon harmonized (80 ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Biochemistry 2020Quote: Full-length wild-type human ASPA cDNA with an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). The C152W variant was generated by Genscript ...
-
bioRxiv - Microbiology 2019Quote: ... Wild-type MreB and a series of amber codon mutants (Table S1) were synthesized by Genscript (Piscataway, NJ) and used to replace the IPTG-inducible YFP to create a plasmid encoding Plac-MreB and Para-AiMB (pMreBXL1-26) ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length wild-type human FLCN cDNA carrying an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript) ...
-
bioRxiv - Molecular Biology 2022Quote: DNA representing wild-type full length p53 mRNA (NCBI Reference Sequence: NM_000546.6) was synthesized and cloned into pUC57 by Genscript. All DNA constructs were obtained by conventional PCR amplification using Platinum Taq DNA Polymerase (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... The HA-tagged wild-type PITPα/β constructs and PI-binding deficient mutants T59D33 were purchased from Genscript. Constructs were transfected in mammalian cells by the lipid-based delivery system from Invitrogen (LipofectamineTM3000 ...
-
bioRxiv - Microbiology 2024Quote: The codon optimized DNA sequence coding for the wild type gorilla FV Env ectodomain from strain SFVggo_huBAK74 (accession code JQ867464.1, [54]) was synthesized by Genscript and cloned into a modified pMT/BiP insect cell expression plasmid (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Molecular Biology 2023Quote: Vectors for expression in mammalian cells of N-terminally 3XFLAG-tagged wild type and mutant forms of human eIF3G were prepared by inserting the appropriate wild type ORF into pcDNA3.1(+)-N-DYK and using the resulting vector for mutagenesis (GenScript).
-
bioRxiv - Bioengineering 2023Quote: The L1 gene fragment sequences of human papillomavirus (HPV) types 16 and 18 were incorporated into the pCDNA3.1(+) plasmid by Genscript. To amplify the specific regions of interest ...
-
bioRxiv - Genetics 2024Quote: ... Rbbp5 (NM_140952.3) wild-type and variant (p.T231I and p.E295D) lines were obtained (clone OFa19095D, GenScript USA, Inc., NJ, USA). Constructs were transformed using high efficiency E ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Synthetic gene construct and the corresponding site-specific mutants for WT SadP(125-328) type PN were obtained from Genscript. Site-specific mutants constructed were Δ244-246 (PSAD-1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli codon-optimized genes for expression of the type III-A Csm complex from Streptococcus thermophilus (SthCsm) were synthesized by GenScript and cloned into three different vectors ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2023Quote: Gene sequence (after codon optimization) of wild-type ubiquitin and its mutants (UbG76C) were cloned into pET22b(+) vectors (GenScript, Nanjing). The plasmid was transformed into BL21(DE3 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).