Labshake search
Citations for GenScript :
101 - 150 of 332 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells expressing Hu08TM were stained with biotinylated protein L (GenScript, Piscataway, NJ) and secondary detection was achieved by the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Biochemistry 2022Quote: ... The primary antibody (rabbit anti-ScV-L-A peptide serum by GenScript) was diluted at 2:25000 in 2% (w/v ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The DNA fragments corresponding to the N-termini of archaeal uS12 were purchased from GenScript (https://www.genscript.com) and cloned into the H ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2021Quote: Purified PX domain was specifically labeled on its N-terminal glycine with a FITC-LPETGG peptide (Genscript) in a Sortase-mediated reaction according to the protocol described in (Theile et al ...
-
bioRxiv - Plant Biology 2019Quote: ... The N-terminal part of the PKL protein (aa 1-586) was synthetized by GenScript (http://www.genscript.com). Details of the molecular cloning work are provided in the Supplementary Experimental Procedures.
-
bioRxiv - Biochemistry 2022Quote: ... and human CDC73 sequences with an N-terminal Flag tag were synthesized and sequences confirmed by GenScript. The human ubiquitin sequence with an inserted N-terminal cysteine residue was synthesized by Eurofins ...
-
bioRxiv - Neuroscience 2022Quote: ... codon optimized mouse Pcbp2 clone with N-terminal Flag epitope tag was produced by gene synthesis (Genscript) and cloned in pcDNA3.1 (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: The codon-optimized sequence coding for the wild type (WT) N (stain Long) was syn-thetised (GenScript) and cloned in the pFastBac Dual vector under the control of the polyhedrin promoter at BamHI and SalI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... and H2A.Z N-terminal tail peptides with and without modifications were purchased from GenScript (Piscataway, NJ, USA). Amino-acid sequence information of each peptide is available in Table 1 ...
-
bioRxiv - Biophysics 2023Quote: All HP1α tagged constructs with a 6x-His tag on the N-terminus were ordered from Genscript. Rosetta competent cells (Millipore Sigma 70954 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Molecular Biology 2021Quote: ... BIOD2-nlsKO-ARS2n mutant was generated by mutagenesis of BIOD2-ARS2n and subcloned in pcDNA3.1(+)-N-eGFP (GenScript). All constructs were validated by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... 2.5×106 splenocytes were stimulated with S or N peptide libraries (GenScript, 15mers with 11aa overlap, 1μg/ml), 0.1% DMSO ...
-
bioRxiv - Cell Biology 2021Quote: N-terminally Histidine (His)-tagged Bin1b SH3 from zebrafish was cloned into pET-28a (+) expression vector (GenScript®). Full length zebrafish Cavin4a (Cavin4a-FL ...
-
bioRxiv - Biochemistry 2020Quote: Full-length wild-type human ASPA cDNA with an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). The C152W variant was generated by Genscript ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... as the primary antibody and anti-Rabbit IgG conjugated to HRP (cat. n° A01827, GenScript, Piscataway, NJ, USA) (2/5000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The plasmid encoding human FPR2 with an N-terminal SNAP-tag was obtained from Genscript (Piscataway, NJ, USA); it was constructed by replacing GLP1R in the previously described pcDNA3.1(+)-Flag-SNAP-GLP1R plasmid [26] with human FPR2 ...
-
bioRxiv - Microbiology 2022Quote: ... Peptides were commercially synthesized and biotin-labeled on the N-terminus using Fmoc chemistry (GenScript, Piscataway, NJ, USA). Sequences of these peptides are shown in Table 1.
-
bioRxiv - Molecular Biology 2020Quote: Full-length wild-type human FLCN cDNA carrying an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-Fyve is generated by insertion of synthesized SARA1 Fyve domain into pCDNA3.1+N-EGFP plasmid from Genscript as described 40 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... Urocortin 3 (Ucn3; GenScript USA, Piscataway, NJ: 60pmol/0.4μl/side) was dissolved in DMSO (10% v/v final concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... two polypeptides with the sequence MQDDLLMDKSKTGGGGASSSWNTHQ (with and without an N-terminal Dansyl group) were also obtained from Genscript. All the peptides were over 95% pure ...
-
bioRxiv - Cell Biology 2019Quote: Chemically synthesized peptides bearing an N-terminal FITC-Ahx modification (Figure S2C) were purchased from from GenScript (Piscataway, NJ), Peptide stock solutions were prepared in milli-Q H2O except LEM275-122 stocks ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 variant spike constructs with N- and C-terminal flag tags were produced and cloned into a pcDNA3.1 vector by GenScript Biotech (Piscataway ...
-
bioRxiv - Microbiology 2020Quote: ... was synthesized with a modified tPA signal peptide (57) at the N-terminus and cloned into the vector pcDNA3.1+ at the cloning sites of KpnI/NotI (GenScript). Expi293 cells (Thermo Fisher ...
-
bioRxiv - Genetics 2022Quote: ... Human GKRP (Ensembl ENST00000264717.7) was codon optimized for yeast expression and cloned into pDONR221 with an N-terminal HA-tag (Genscript). For yeast expression ...
-
bioRxiv - Bioengineering 2019Quote: ... Scrambled (Ac-AGVGDHIGC, to make GelMA-Scram) or N-Cadherin mimic (Ac-HAVDIGGGC, to make GelMA-Cad) peptides (GenScript) were added to the GelMA/TEOA buffer to form a 1% w/v solution ...
-
bioRxiv - Molecular Biology 2021Quote: All the MSH2 constructs and the M453I mutant were obtained through gene synthesis or mutagenesis and cloned in pcDNA3.1(+)-N-eGFP by GenScript. These MSH2 constructs contain a N-terminal SV40 NLS to achieve nuclear localization.
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: Vectors for expression in mammalian cells of N-terminally 3XFLAG-tagged wild type and mutant forms of human eIF3G were prepared by inserting the appropriate wild type ORF into pcDNA3.1(+)-N-DYK and using the resulting vector for mutagenesis (GenScript).
-
bioRxiv - Biophysics 2024Quote: The unlabelled N-acetylated ORF6CTR peptide (NAc-ORF6CTR) with sequence Ac- SKSLTENKYSQLDEEQPMEID was produced synthetically (> 96.3% purity) by GenScript (GenScript Biotech UK Limited ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic genes with N-terminal histidine tag (either 6-His or 10-His for ROCKETAAXWA) were synthesized by Genscript Inc or derived from mutagenesis in a pet26b (+ ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...