Labshake search
Citations for GenScript :
51 - 100 of 332 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript). All mutations were generated by Genscript ...
-
bioRxiv - Developmental Biology 2019Quote: ... purified and N-terminally conjugated with KLH prior to injection (GenScript, USA). Polyclonal antibodies were affinity purified on the antigen and concentrated to 1.5 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal acetylated ChREBP peptide used for crystallization was purchased from GenScript Biotech Corp ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expressed in the pMA vector (pMA-SthCas6-4xcrRNA-N-gene, GenScript). Cas10 gene with 15HD>HA and 573GGDD>GGAA mutations was synthesized and cloned in pACYCDuet1-SthCas10-SthCsm2 plasmid using NcoI and NotI restriction sites ...
-
bioRxiv - Biochemistry 2023Quote: ... which contains an N-terminal pelB signal sequence and hexahistidine tag (Genscript). The construct was transformed into chemically competent C41 (DE3 ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The primary antibody against Ft-L was made using recombinant human Ft-L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2021Quote: ... and S1 subunit (0.5 µg/mL) (cat n° Z03501, GenScript, Piscataway, NJ, USA) purified recombinant proteins dissolved in carbonate-bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were used to test activity in vitro against N- terminal peptides (Genscript) using 5,5-dithio-bis-(2-nitrobenzoic acid ...
-
bioRxiv - Bioengineering 2020Quote: ... for detection of anti-L and anti-D antibodies plates were coated with either L-MMP peptide or D-MMP peptide resepcitvely (GenScript; sequence above) Serum samples were tested at a 1:500 dilution followed by incubation with alkaline phosphatase-labeled goat anti-mouse IgG1 or IgG2a ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with Biotin-Protein L (Genscript) followed by fluorescently-conjugated streptavidin.
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2020Quote: ... UK) and CAR combinations with anti-CD19(fmc63) scFv were assessed by staining with Protein-L (Biotin-Protein L, GenScript, Piscataway, NJ, USA). In both cases ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copy number/mL supernatant was assessed using pCDNA3.1(+)-N-eGFP plasmid (GenScript) as standard.
-
bioRxiv - Biochemistry 2021Quote: The gene for N102LT N-terminally fused with tagRFP (gi: 336287738) was synthesised (GenScript) and inserted to unmodified pQlinkN plasmid using restriction enzyme cloning ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with biotinylated protein L (GenScript, Piscataway, NJ), goat anti-mouse IgG ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-biotinylated synthetic peptides (ctrl, pY, or Y816A; Genscript, USA, sequences described in figure 1h) of the last 26 amino acids (aa ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Cell Biology 2020Quote: Sequences of full length hsRIPK2 with an N-terminal 3x-Flag tag were synthesized by Genscript and cloned into doxycycline-inducible lentiviral expression vectors (pF_TRE3G_rtTAAd_puro (Takara Bio)) ...
-
bioRxiv - Biophysics 2022Quote: ... which was synthesized with an N-terminal fluorescein label (5-FAM, GenScript USA Inc. Piscataway, NJ). Fluorescence polarization measurements were carried out in black 96-well plates measured on a Wallac Victor 2 Plate Reader (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... archaeon HeR gene (GenBank ID: KYK26602.1) containing an N-terminal histidine-tag was chemically synthesized (GenScript) and subcloned into the pET21a (+)-vector ...
-
bioRxiv - Neuroscience 2020Quote: NR peptide was synthesized with a N-terminal 5-FAM modification by GenScript (Piscataway, NJ, USA). Hsp70 was titrated in triplicate while the NR-peptide concentration remained constant at 20nM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...