Labshake search
Citations for GenScript :
101 - 150 of 1246 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Biochemistry 2024Quote: WT-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-2/PD40693), N112C-CCNE1-3xFLAG (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of 800 nM LwaCas13a (Genscript), 1 μL of a 1.6 μM target-specific Cas13 crRNA ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of reporter (1000 nM, GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 2 µL of 500 nM LwaCas13a (GenScript, #Z03486 ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Neuroscience 2022Quote: ... basic and Methyl-mimic mutants were synthesized by Genscript with N-terminal NheI and C-terminal Acc65I restriction enzyme site s flanking the DUX4 ORF ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Cancer Biology 2024Quote: ... NUSAP1-whole-mCherry (amino acids 1-441) and YY1-whole-mCherry (amino acids 1-414) fusion protein was synthesized by GenScript (Piscataway). Potassium phosphate buffer (pH 7.0 ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: The sequence encoding the NSP3 ubiquitin-like domain 1 (Ubl1, residues 1-110) of SARS-CoV-2 was synthesized by Genscript Biotech and inserted into the pCMV-3Tag-3A plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 pseudoviruses were purchased from GenScript, and neutralization activity was measured using the HEK-293T-ACE2 cell line with the same procedures as mentioned above.
-
bioRxiv - Biophysics 2020Quote: The CoV-2 3CLpro sequence was synthetized (GenScript) for optimized expression in E ...
-
bioRxiv - Immunology 2020Quote: ... using IgE-SARS-CoV-2 spike plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 fusion peptide was synthesized (GenScript).
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded onto a gravity Ni-NTA column (2-5 ml Ni-charged resin FF from GenScript, Cat# L00666-25). The Ni-NTA column was washed and then the His-tag fused protein was eluted using step-gradient of imidazole (50 ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of pseudovirus infection of cells containing SARS-CoV-2 receptors was performed on serum specimens using two commercially available SARS-CoV-2 LVV-PsN Kit (SC2087A; SC2087L; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... based on antibody-mediated blockage of ACE2 binding to SARS-CoV-2-RBD was performed on serum specimens using a commercially available SARS-CoV-2 sVNT Kit (L00847; GenScript, Nanjing, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Immunology 2022Quote: ... 10-residue SARS-CoV-2 S2 peptide FKEELDKYFK (GenScript) was dissolved in 100% DMSO at 10 mg/mL and then diluted with PBS to 1 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Nucleocapsid was purchased from Genscript (Z03480). SARS-CoV-1 spike (40634-V08B) ...
-
bioRxiv - Plant Biology 2021Quote: ... flg22 (2 µM; Genscript, Piscataway, Township, New Jersey, USA). All PAMPs were dissolved in 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... Following the injection of 2 units PreScission Protease (GenScript), the column was sealed and placed on a rotator at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...