Labshake search
Citations for GenScript :
1 - 50 of 1246 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 kPa (5% 40 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), and 35 kPa (7% 20 kDa 8-arm PEG-NB ...
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.
-
bioRxiv - Immunology 2022Quote: ... Samples were stimulated using pooled Spike peptides of SARS-CoV-2 (Final concentration:1μg/mL, 15-mer peptide with 11 amino acids covering the spike region, Genscript) and cultured at 37°C with 5% CO2 for 20 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Mice were immunized with SARS-CoV-2 Spike protein (5 µg, Val16-Pro1213, wild type, Genscript) with Alhydrogel® adjuvant 2% (InvivoGen ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... OLP peptide pools of 15mers with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD (R319-S591, GenScript). Sequences that contained VOC mutations were exchangeable with the corresponding mutated peptides due to a modular OLP pool design.