Labshake search
Citations for GenScript :
1151 - 1200 of 1382 citations for Mouse Anti Dengue Virus Envelope Protein Serotype 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and 500 μL of tissue culture media containing 500 pM GLP-1 (GenScript) added to the lower chamber ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were arrested in G1 with 100 ng ml-1 alpha factor (GenScript) and incubation was continued for 3 hours ...
-
bioRxiv - Immunology 2019Quote: ... NY-ESO-1 (157-165; SLLMWITQV) peptide was purchased at >95% purity (GenScript). Purified peptide-HLA-A*02 was biotinylated in vitro by BirA enzyme (Avidity ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... immature BMDCs were harvested and loaded with 1 μg/ml OVA257-264 (GenScript), B16-OVA-Ogt+/+ and B16-OVA-Ogt−/− cells supernatant at 37°C for 6 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 dish per sample) were transfected with FLAG-GFP and FLAG-SF3B2 (GenScript) (14 µg DNA per dish ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pulsed with 1 µg/mL SIINFEKL peptide (Genscript, Piscataway, NJ, USA) for 1 h at 37 °C prior to use as targets for mouse OTI CTLs.
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Bioengineering 2019Quote: ... The anti-DENV scFv was then subcloned into the final vector from a gene-synthesized plasmid (GenScript, Piscataway, NJ) using PmeI and PacI sites and traditional ligation cloning ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant human ACE2-ECD fused with Flag/His tag was produced in 293T cells and purified with anti-DYKDDDDK G1 Affinity Resin according to the manufacturer’s instructions (GenScript).
-
bioRxiv - Cancer Biology 2022Quote: ... The secondary antibody solution consisted of MonoRab ™: Rabbit Anti-Camelid VHH Antibody [HRP] mAb (GenScript, Cat. # A01861-200) (1:5000 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biophysics 2024Quote: ... The insoluble fraction was removed by ultracentrifugation at 180,000g for 30 min and the supernatant was then incubated with Anti-DYKDDDDK M1 resin (Genscript) for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: We produced a series of novel monoclonal anti-tau antibodies (MD series) with a contract research organization (CRO, Genscript). The CRO synthesized linear peptides with sequences corresponding to amino acids 263-281 (R1R2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sample was clarified by centrifugation at 30,000 rpm for 30 min and the supernatant was then incubated with anti-DYKDDDDK Affinity Beads (GenScript) for 3 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and then incubated with the Anti-DYKDDDDK G1 resin (Genscript) for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... which was detected using an affinity-purified rabbit polyclonal anti-ORF59 antibody that was generated (GenScript, Piscataway, NJ, USA) against the peptides GKKTRGGNKASDSGT and KRPPPKKDREPTTKRPKL ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and then incubated with the Anti-DYKDDDDK M2 resin (Genscript) for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... was added to wells either alone or with CGRP (1, 10, 100 nM, GenScript) and incubated for 72 hr ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Microbiology 2020Quote: ... The samples were then heated for 5 minutes at 85°C and separated by SDS-PAGE and analyzed by Western blot using rabbit anti-GST antibody (Genscript), rabbit α-RSV CA ...
-
bioRxiv - Genomics 2020Quote: ... Lines were then analyzed for TALE expression by western blot using an anti HA-tag antibody (Genscript Cat# A00168-40).
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 17 amino acids predicted by the software to be involved in the interaction between anti-CfaE nanobodies and the N-terminal portion of CfaE were individually by Genscript. The genes were cloned into pMAL-C5x vector ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166) diluted 1:5000 in dilution solution were added to each well ...
-
bioRxiv - Plant Biology 2022Quote: ... the gels were firstly analyzed through immunoblotting with anti-PDR6 antibody (prepared with peptide CTVVEEGKDKHKGSH as antigen by GenScript, China) and a horseradish peroxidase-conjugated antirabbit IgG secondary antibody (Beyotime Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... Bound IgG was detected as the luminescence signal at 425 nm using an HRP-conjugated anti-human IgG (H&L) secondary antibody (Genscript) and SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Tmod3 amino acid sequence with locations of peptides (red – Nterm, blue - Cterm) used to custom prepare chicken anti-Tmod3 antibodies (Genscript). A commercial rabbit anti-Tmod3 antibody (Aviva ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript) ...
-
bioRxiv - Neuroscience 2023Quote: ... FOLR1 was immunoprecipitated by overnight incubation of lysates with rabbit anti-Xenopus laevis FOLR1 polyclonal affinity purified antibody raised against the peptide KHQKVDPGPEDDLHC (custom made by GenScript), chemically cross-linked to protein G-agarose beads at 4°C on a mini-rotator ...
-
bioRxiv - Biochemistry 2023Quote: ... The successful removal of His-tag was validated by western blot using the anti-His-tag antibody (Genscript, A00186-100).
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with subsequent immunoblotting against either the FLAGepitope tag or TWIN-Strep epitope tag (Anti-FLAG M2, Sigma-Aldrich; THETM NWSHPQFEK antibody, GenScript).
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Klickmer® molecules loaded with biotinylated rE2 were incubated with 5uL purified anti-E2 AR3C monoclonal IgG1 antibody (1mg/mL, Genscript) for 20 minutes in the dark ...