Labshake search
Citations for GenScript :
801 - 850 of 1389 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant antibody was cloned and produced by Genscript. Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunization and antibody purification were performed by Genscript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...
-
bioRxiv - Plant Biology 2024Quote: ... DM3 antibody from mouse was generated by Genscript using peptide CAKKEDWPPLYDVPR ...
-
bioRxiv - Developmental Biology 2024Quote: Rabbit anti-GFP poly clonal antibody (GenScript A01388) Dilution 1:500 anti-Fibrillarin(38F3 ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... coli codon-optimized gene of the full-length protein L3P mutant purchased from GenScript, using the primers in Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of protein samples were loaded and separated on 10% SDS gels (GenScript). Subsequently ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1.5 mg of Mlβ-cat protein collected via PreScission Protease (GenScript cat.# Z02799) digest and 6 mg of Mlβ-cat-GST protein collected via 10 mM glutathione whole protein elution were sent to Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... in the position of the E-box as well as 1 kb homology arms (60) were created by gene synthesis (GenScript) and cloned into pUC57 ...
-
bioRxiv - Microbiology 2020Quote: ... as well as two mutants TANV16L (K52A and R90A) lacking 23 C-terminal residues were cloned into the bacterial expression vector pGex-6p-1 (Genscript). Recombinant TANV16L was expressed in C41(DE3 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... simulansOr67a.P we generated a T2A-Gal4 targeting vector flanked by homology arms (1-1.1 kb) via gene synthesis (GenScript Biotech) as described [70].
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Biochemistry 2021Quote: The codon-optimized sequences for the three subunits of avian influenza A/Goose/Guangdong/1/1996 (H5N1) virus polymerases were synthesized (GenScript) and cloned into pFastBac expression plasmid for polymerase expression and structure determination ...
-
bioRxiv - Biophysics 2020Quote: The DNA sequence coding for hGHR-ECD (1-245, C242S, no signal peptide) in a pET11a was bought from Genscript and transformed into competent Rosetta2 (DE3)pLysS cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Targeting to the MGAT2-positive compartment was achieved by inserting synthetic truncated MGAT2 (residues 1-89 of Uniprot Q10469, Genscript) in the vector for cytosolic expression of RpHLuorin2 with restriction sites EcoRI and BamHI ...
-
bioRxiv - Bioengineering 2021Quote: ... under two different RNP complexing conditions: 1) 10 mins at 25°C or 37°C with nuclease reaction buffer (GenScript) and 2 ...
-
bioRxiv - Plant Biology 2020Quote: Custom peptide libraries corresponding to NRPD1 amino acids 1-300 or RDR2 amino acids 771-971 were obtained from Genscript and dot-blotted (10 ng ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... and TIN2S (HA-TIN2S, 1-354 aa) were expressed in the Sf-900 insect cells using the pFastBac1 expression system (GenScript). HA-TIN2L and HA-TIN2S were purified using anti-HA resin and stored in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the S protein ectodomains (residues 1-1194) from bat SARS-related CoV isolates Rs4231 and Rs4874 (ref.(Hu et al., 2017)) were synthesized (Genscript) with a C-terminal T4-Foldon domain or C-terminal GCN domain ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
bioRxiv - Immunology 2020Quote: ... splenocytes were cultured in RPMI-1640 supplemented with 10% fetal bovine serum in the presence of 1 ug/ml of LCMV-gp peptide (Genscript) and 5 ug/ml of Brefeldin A (Biolegend ...
-
bioRxiv - Microbiology 2021Quote: ... coli K-12 MG1655 thymidylate kinase alleles (WT, Q45P, and A69T) were amplified and cloned into the plasmid expression vector pRSFDuet-1 (GenScript). Expression is under control of the T7 lac promoter ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were incubated on a rotator for 1 h at room temperature and then incubated with 15 μL of a 25% slurry of nickel-charged MagBeads (Genscript) for an additional 1 h on the rotator at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a synthetic gene fragment encoding the extracellular region of a metagenomic FsxA ORF (IMG genome 3300000868, scaffold JGI12330J12834_ 1000008, ORF 8; Source Data Table 1) (GenScript) was subcloned by PCR in frame with the 5’ chicken Crypα signal peptide- and 3’ 8xHis-tag-encoding sequences of pLJ6 ...