Labshake search
Citations for GenScript :
701 - 750 of 1389 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (25 ...
-
bioRxiv - Cell Biology 2020Quote: ... Coronin peptide antibody was generated by GenScript as peptide-KLH conjugation in New Zealand rabbits (sequence in Table 3) ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-Loqs antibody (custom generated by GenScript), Anti-HA antibody (ab130275 ...
-
bioRxiv - Immunology 2020Quote: ... and the CD3/CD4 bispecific antibody (Genscript) to expand CD8 T-cells ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript). After washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... anti-Cas9 antibody (Genscript, Cat# A01935, USA) 1% BSA mixture overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: Identified antibody sequences were synthesized by Genscript and subcloned into mammalian expression vectors for recombinant expression in an IgG2a format as described117 ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-c-Myc Antibody (GenScript, NJ) solution at a 1:100 ratio in PBSA buffer (0.25 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... Antibody expression cassettes were synthesized by Genscript and were subcloned into pENN.AAV.CB7.CI for vectorization ...
-
bioRxiv - Biochemistry 2024Quote: ... or FLAG-antibody-coated beads (Genscript, L00432). Bound proteins were eluted with 50 mM of biotin or 0.2 mg/mL 1xFLAG (DYKDDDDK ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell adhesion was enabled in all hydrogel groups through incorporation of either 1 mM RGD peptide (GCGYGRGDSPG, Genscript) or 2 μM thiolated Fn fragments (Fn9*10 or Fn4G) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were incubated for 1 hr at RT with horseradish peroxidase-conjugated anti-rabbit IgG (GenScript, A00098) or anti-mouse IgG (Pronteintech ...
-
bioRxiv - Microbiology 2021Quote: ... The left and right homology donor templates and the P4::gRNA constructs (Table 1) were synthesized by GenScript and inserted into the NheI and PvuII sites of pTMS001 generating pTMS007 and pTMS008 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the DABCYLGlu-EDANS labelled peptides encompassing the different cleavage sites (SI Table 1) were purchased from Genscript. Reactions were performed at room temperature in black 384-well polystyrene low volume plates (CELLSTAR-Greiner Bio-One # 784476 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA encoding TeNT-LC-HN (residues 1-870) and TeNT-HC were synthesized by GenScript (Piscataway, NJ). A thrombin protease cleavage site was inserted between I448 and A457 in both TeNT-LC-HN and chTeNT-LC-HN ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Cell Biology 2023Quote: ... The pGEX-6P-1-GST-OSBP(377-807) and pET28(+)-ORP2(49-480) plasmids were purchased from Genscript. The pET22b_His6_STARD1(66-284 ...
-
bioRxiv - Cell Biology 2023Quote: ... coli were generated through custom synthesis and subcloned into an expression backbone (pETDuet-1) by Genscript (Piscataway, USA), as has been previously reported110.
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then pulsed with 20μg/ml OVA323–339 peptide (GenScript, Piscataway, NJ, Cat. No. RP10610-1) for 2 hours at 37℃ and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Biochemistry 2024Quote: ... The FAM-labeled fluorescent FTH-1 IRE probe with the sequence 5’- UCCUGCUUCAACAGUGCUUGGACGGAAC-3’ was prepared by GenScript Biotech (Netherlands) ...
-
bioRxiv - Microbiology 2024Quote: ... The pilA ACICU negative and αβ-loop mutants (sequences available in Supplementary Table 1) were synthesized by Genscript and ligated into pUCP20GM (33 ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligand stimulation by 50 ng.mL-1 of either Human VEGF165a or PLGF1 (Genscript #Z02689, RnD #264-PGB-010) for 0 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... The secondary antibody solution consisted of MonoRab ™: Rabbit Anti-Camelid VHH Antibody [HRP] mAb (GenScript, Cat. # A01861-200) (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were then incubated with antibody (anti-Myc antibody 9E10 or anti-CycB3, from rabbit, custom-made by Genscript) for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... The next morning the buffer was replaced with 10 ml new TBST (2.5% milk) and primary antibody added (polyclonal rabbit antibodies ordered from GenScript). The antibody used for each blot is indicated in the figure ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times with goat anti-rabbit IgG antibody or goat anti-mouse IgG antibody (GenScript) for one hour followed by washing three times with TBST again ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bound proteins were eluted with Flag peptide (200 μg/ml; GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were transferred to PVDF membranes using an eBlot (GenScript Biotech, Piscataway, NJ) and the membranes were Western blotted for Tom40 and Tom70 ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were used to test activity in vitro against N- terminal peptides (Genscript) using 5,5-dithio-bis-(2-nitrobenzoic acid ...
-
bioRxiv - Immunology 2024Quote: ... by means of the eBlot L1 Protein Transfer System (Genscript, Piscataway, NJ, USA), proteins were transferred from the gel onto a prepared WesternBright NC nitrocellulose membrane (Advansta Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...