Labshake search
Citations for GenScript :
751 - 800 of 905 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Cells were subsequently washed with PBS and stained with α-camelid VHH antibodies (1:100, clone 96A3F5, Genscript) in 200 µl Cell Staining buffer for 30 min at 4 °C ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Squash leaf curl China virus Rep (KC222956.1) and the TYLCV infectious clone (based on AJ489258.1) were synthetized by GenScript. Clones for the coding sequences of AtSCE1 (At3g57870 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-FLAG was from Genscript (Nanjing, Jiangsu). FITC-conjugated goat anti-mouse ...
-
bioRxiv - Cancer Biology 2022Quote: The open reading frame of mouse GPx2 (GenScript NM_030677.2) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... The mouse Tmem63b gene (NM_198167) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2023Quote: Recombinant mouse interleukin-11 (rmIL11) (Z03052, Genscript, Oxford, UK) was dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2024Quote: ... Cells were incubated with mouse anti-P30 mAb (GenScript) and Rabbit anti-HA tag polyclonal antibody (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... The full-length native chicken ovalbumin (OVA) gene inserted in a pcDNA3.1+ plasmid (clone ID: OGa28271) was purchased from GenScript. Gene inserts from pcDNA3.1+ plasmids were cloned into the pAM2AA backbone incorporating the liver-specific human α-1 antitrypsin promoter and human ApoE enhancer flanked by AAV2 inverted terminal repeats ...
-
bioRxiv - Microbiology 2022Quote: ... were commercially synthesized and cloned into the multiple clone sites of NdeI/XhoI in vector pET-29a(+) (GenScript, USA), and then were transformed into E ...
-
bioRxiv - Genetics 2024Quote: ... Rbbp5 (NM_140952.3) wild-type and variant (p.T231I and p.E295D) lines were obtained (clone OFa19095D, GenScript USA, Inc., NJ, USA). Constructs were transformed using high efficiency E ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2020Quote: ... with a plasmid containing the complete human ACE2 transcript variant 1 cDNA sequence (NM_001371415.1) cloned into the mammalian expression vector pcDNA3.1-C’ FLAG by Genscript. Cells were grown in Iscove’s Modified Dulbecco’s Medium (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Microbiology 2023Quote: The cDNA copies encoding the HA1 consensus or mutant sequences were synthesized by Genscript (Piscataway, NJ, USA) and then sub-cloned into the plasmid pDP-BsmbI-WF10_HA2 encoding the HA2 portion of WF10 ...
-
bioRxiv - Bioengineering 2023Quote: ... The variable regions of M2 and M6 hybridomas were sequenced after generating cDNA internally or by GenScript with permission from Dr ...
-
bioRxiv - Biochemistry 2023Quote: The cDNA of wild-type PRKN or PRKN variants studied in low-throughput were purchased from Genscript. Single PRKN variants were integrated into the Tet-on landing pad in the HEK 293T TetBxb1BFPiCasp9 Clone 12 cell line ...
-
bioRxiv - Molecular Biology 2023Quote: HA encoding cDNAs of A/turkey/Italy/214845/02 H7N3 (63) (synthesized and codon-optimized by GenScript), A/duck/Australia/341/1983 H15N8 (a kind gift from Keita Matsuno) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA of human STK25 isoform 1 (RefSeq accession no. NM_001271977.2) was cloned into the pcDNA3.1+ vector (GenScript). The Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Plant Biology 2024Quote: ... VKWFNNAK) from CspD was commercially synthesized with a DABCYL N-terminal modification and an EDANS C-terminal modification (GenScript, Piscataway, New Jersey, United States) at a purity of 95.7% ...
-
bioRxiv - Cancer Biology 2024Quote: ... designed to introduce mScarlet or mEmerald to the N-terminus of NPM1 using a pUC18 backbone were ordered from GenScript (Piscataway, New Jersey, USA). HeLa cells were nucleofected with the HDR plasmid and the gRNA cas9 plasmid and allowed to recover for 3 days before selection with G418 for 7 days ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Immunology 2023Quote: ... with 200 μg of recombinant mouse IFN-γ alone (Genscript), 250 μg anti-CD115 (clone ASF98 ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Neuroscience 2024Quote: Mouse monoclonal tau antibody 8B2 IgG1κ was generated by GenScript as previously described by immunizing BALB/c mice with a peptide encompassing to pSer396/404 region of the tau protein that was conjugated to keyhole limpet hemocyanin via a cysteine residue (cTDHGAEIVYK(pS)PVVSGDT(pS)PRHL ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of hPINK1 constructs for insect cell expression and test purifications The coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by PCR using primers 1941 and 1942 and as a template the clone in PD912-GAP which was obtained from Genscript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Nb protein sequences acquired from literature (previously named 22A3 and 23A3)35 were codon optimized for bacterial expression and cloned into a pET26b expression in frame with pelB and His6 sequences using clone EZ service from GenScript. The production and purification of Nb6E (previously named VHH05 ...
-
bioRxiv - Genetics 2023Quote: An antibody against CENP-C made in guinea pig was made by generating a clone expressing amino acids 502-939 (Genscript). This guinea pig anti-CENP-C was used at 1:1000 ...
-
bioRxiv - Plant Biology 2020Quote: ... reinhardtii RAF1 (Cre06.g308450) was expressed in E.coli using a codon-adapted synthetic cDNA (Genscript, Piscataway, NJ, USA). The protein was purified using GST-tag affinity and used directly as an antigen in rabbits (Genscript ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA encoding TeNT-LC-HN (residues 1-870) and TeNT-HC were synthesized by GenScript (Piscataway, NJ). A thrombin protease cleavage site was inserted between I448 and A457 in both TeNT-LC-HN and chTeNT-LC-HN ...
-
bioRxiv - Plant Biology 2024Quote: The quenched peptides (Qps) from flagellin were commercially synthesized with a DABCYL N-terminal modification and a Glu-EDANS C-terminal modification (GenScript, Piscataway, New Jersey, United States) at a purity of 95% (Supplemental Table S3) ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... with mouse-anti-FLAG-iFluor647 (1:500) (Genscript, Piscataway, NJ, USA) or anti-human IgG Fc Alexa Fluor 647 (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... All synthesized sequences were codon-optimized for mouse expression (GenSmart, GenScript).