Labshake search
Citations for GenScript :
501 - 550 of 905 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... we first synthesized a cassette coding the FKBP-derived destabilization domain (DD)33 along with an EcoRI restriction site and a single FLAG tag (Genscript). This cassette was then cloned into pHIV-NAT-T2A-hCD52 (kind gift of R ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The SARS-CoV-2 sp12 gene was codon optimized and cloned into pFastBac with C-terminal additions of a TEV site and strep tag (Genscript). The pFastBac plasmid and DH10Bac E ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by a TEV cleavage site and a hexahistidine-tag was cloned between NdeI and BamHI restriction sites of a pET-11a vector by Genscript with a codon optimization ...
-
bioRxiv - Cell Biology 2020Quote: Arhgef11CA with a membrane targeting domain and an HA tag with a stop code on the C-terminal was synthesized by GenScript. NheI and Sal I sites were inserted on the 5’ and 3’ ends of the Arhgef11CA cassette ...
-
bioRxiv - Microbiology 2021Quote: ... cholerae biovar El Tor strain N16961 (NCBI NC_002506.1) fused to a histidine-tag coding strip placed C-terminal to parE2 was synthesized by Genscript (https://www.genscript.com/). This gene was subsequently cloned into the NcoI-NheI sites of a pET28a plasmid and verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... or vector containing full-length METTL7A or METTL7B with a C-terminus FLAG tag (all vectors from Genscript, Piscataway, NJ) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Biophysics 2024Quote: Antibodies were obtained from the following sources: Protein C-Tag Antibody (HPC4) (Rabbit polyclonal) was from Genscript (Piscataway, NJ, USA); Anti-Phosphotyrosine Antibody ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... corresponding to amino acids 53-463) fused to a C-terminal hexahistidine tag (two separate pET31a vectors) were purchased from Genscript (all inserts were codon optimized for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of CCPG1 (1-212aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... the cytosol-exposed domain of FKBP8 (1-391aa) fused to a C-terminal GST-tag was gene synthesized by Genscript and cloned into a pET-DUET1 vector ...
-
bioRxiv - Immunology 2023Quote: Double knockout clones for BTN3A1 and BTN3A3 were generated by GenScript. Briefly ...
-
bioRxiv - Biochemistry 2024Quote: The human SRSF3-pET28a clone was purchased from Genscript (Piscataway, NJ). Different SRSF3 variants were subcloned in pET28a and expressed as TEV protease-cleavable N-terminal 6xHis-tag fusions in E.coli Rosetta2(DE3 ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Immunology 2024Quote: ... Fine epitope mapping was performed by ordering synthetic peptides with N-terminal biotin residues (Genscript: 17-mer YHHHHHHDYDIPTTENL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Peptides with N terminal acetylation and C terminal amidation were purchased from Genscript (Rijswijk, Netherlands). Peptides were dissolved in DMSO ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse GPx2 plasmid (GenScript) was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... mouse anti-V5 (GenScript, A01724-100 ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Synthetic Biology 2024Quote: DROP-CAR expression in B3Z cells was evaluated via labeling with a 1:200 dilution of biotinylated anti-Strep tag antibody (GenScript, A01737) binding the TMD-containing chain of the DROP-CAR ...
-
bioRxiv - Microbiology 2024Quote: ... the wells were washed with PBST and incubated with HRP-conjugated Anti-HA tag antibody at 0.5 µg/ml (GenScript, Cat.#A01296) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... we purchased the gene-synthesized codon-optimized cytosol-exposed domain of BNIP3 (1-158aa) fused to a C-terminal GST-tag in a pFastBac-Dual vector from Genscript (RRID:Addgene_223764). Point mutants were introduced by in vitro mutagenesis to generate BNIP3 E44A/L47A/D49A/A50K/Q51A (5A ...
-
bioRxiv - Biochemistry 2024Quote: ... EYA3 and EYA3H79R were expressed with a C-terminal StrepII tag for detection using a Strep antibody (Genscript, A01732, 1:1000).
-
bioRxiv - Microbiology 2020Quote: The cDNAs encoding the ACE2 orthologs were synthesized by GenScript and cloned into the pLVX-IRES-zsGreen1 vector (Catalog No ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA of Add3 was purchased from Genecript (GenScript Bioteh, NJ). The ORF was subcloned into the same vector as that of the αMHC-Add1i2 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA sequences encoding XKR3 and XKR6 were purchased from Genscript and Origene ...
-
bioRxiv - Biophysics 2021Quote: The hHv1 cDNA was codon-optimized and synthesized by Genscript Inc ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA for hHIPK2 isoform 1 was synthesized by GenScript® to match the NCBI reference sequence NM_022740.4 ...
-
bioRxiv - Microbiology 2021Quote: The cDNAs encoding the ACE2 orthologs were synthesized by GenScript and cloned into the pLVX-IRES-zsGreen1 vector (Catalog No ...
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Cell Biology 2023Quote: ... corresponding cDNAs were subcloned under control of Actin5C promoter (GenScript). The resulting constructs had N-terminal Halo or EGFP tags (Nv-Osk ...
-
bioRxiv - Genomics 2023Quote: The SncmtRNA full-length cDNA sequence was synthesized by Genscript Inc ...