Labshake search
Citations for GenScript :
701 - 750 of 954 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Microbiology 2024Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Molecular Biology 2024Quote: ... containing two copies of the 3’ untranslated region (UTR) of the HBB gene and a poly-A sequence of 96 adenines were purchased by Genscript. ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830 ...
-
bioRxiv - Bioengineering 2024Quote: ... NorHA-CDHA hydrogels (3 wt% NorHA-CDHA) were fabricated by first mixing CDHA with a thiolated adamantane peptide (GCKKK-adamantane, Genscript) (1.2:1 molar ratio of Ad:CD ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biophysics 2021Quote: ... Human l-Opa1 (isoform 1) and s-Opa1 with Twin-strep-tag at N-terminus and deca-histindine tag at C-terminus (GenScript, NJ, USA) was expressed in Pichia pastoris strain SMD1163 ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Microbiology 2021Quote: ... of the SARS CoV2 isolate Wuhan-hu-1 genome (Genbank: NC_045512) were commercially synthesized and cloned into pUC57 vector (Genscript, New Jersey, USA). RNA motif plasmid cloning backbone [(pRMB ...
-
bioRxiv - Microbiology 2023Quote: ... A synthetic standard containing base positions 1-200 from the 16S rRNA gene sequence was used for the standard curve (GenScript, Rijswijk, Netherlands). The qPCR was carried out on a Strategene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 x 106 splenocytes were plated into each of five wells of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml of p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37 °C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids and were treated with macrophage colony-stimulating factor (m-MCSF, GenScript, Cat # Z02930-50, 40 ng/ml) for 6-7 days with media change every three days to differentiate bone marrow cells into mouse bone marrow-derived macrophages (BMDMs).
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Microbiology 2020Quote: ... (2) the mScarlet gene (amplified from a P. falciparum codon-adjusted synthetic sequence (Genscript) (Fig ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV and SARS-CoV-2 (GenBank accession number NC_045512.2) were synthesized by GenScript Corporation (GenScript ...
-
bioRxiv - Immunology 2022Quote: ... the standard curve was run using an IgG1 SARS-CoV-2 neutralizing antibody (GenScript) for full quantification ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biochemistry 2023Quote: DNA encoding PEDV and SARS-CoV-2 nsps were codon optimized and synthesized (Genscript). PEDV protein sequences correspond to GenBank AKJ21892.1 ...
-
bioRxiv - Biochemistry 2022Quote: ... and were cultured in the presence of 10 ng/mL IL-2 (Genscript #Z00368), and the presence or absence of TNFα (100 ng/mL ...
-
bioRxiv - Immunology 2024Quote: ... Endotoxin levels of all antibodies were measured to be below 2 EU/mL (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit).
-
bioRxiv - Microbiology 2024Quote: ... and SARS-CoV-2 D614G (GISAID Accession: EPI_ISL_5851484) were synthetized by GenScript (Piscataway, NJ) and cloned into pVRC8400 or pcDNA3.1(+ ...
-
bioRxiv - Plant Biology 2024Quote: ... were synthesised with Gateway-compatible attL1/2 sites and cloned into pUC57 by Genscript. 1-21aa-mCitrine includes a start codon with MtAPI bases 1528 to 1587 fused to the shortAPI-linker-mCitrine sequence ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... mice were intravenously injected with 0.1 mg (from a solution of 1mg/ml in PBS) of VP2121-130 (FHAGSLLVFM) or control E7 (RAHYNIVTF) peptide (GenScript, Piscataway, NJ, USA) into the tail vein.
-
bioRxiv - Microbiology 2021Quote: The cyc2 gene of Mariprofundus ferrooxydans PV-1 (accession no. AKN78226) was codon-optimized for expression in Escherichia coli and synthesized by Genscript (Piscataway, NJ, USA) with a C-terminal Strep-tag II (WSHPQFEK ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Cancer Biology 2023Quote: ... Also included were 100 AAVS1-targeting “safe harbor” guides taken from a separate CRISPR library.29 Each sequence was appended with the same universal prefix and suffix sequences and synthesized commercially in pooled format (GenScript, Supplementary Table 1).
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-AQP4 (1:4000, GenScript Biotech, Piscataway, NJ, USA), rabbit polyclonal anti-AQP4ex (1:2000 ...
-
bioRxiv - Biophysics 2024Quote: ... The purified pigments were eluted with buffer A containing 0.5 ∼ 1 mg/mL 1D4 peptide (custom peptide synthesis by GenScript Japan Inc., Tokyo, Japan). To obtain pigments in solutions of various anions (SO42− ...