Labshake search
Citations for GenScript :
651 - 700 of 954 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Microbiology 2021Quote: ... codon-optimized SARS-CoV-2 ORF3 and E genes were synthesized by GenScript Biotech (Piscataway ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH) ...
-
bioRxiv - Molecular Biology 2022Quote: The sequence for Rab7A (residues 2-176, uniprot P51149) was purchased from Genscript, N-terminally fused to a His tag and tobacco etch virus (TEV ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Biophysics 2023Quote: ... The expression clone of ppSUMO-2_SARS-CoV-2 NSP16 was obtained from Genscript. Expression was carried out in E ...
-
bioRxiv - Microbiology 2023Quote: Full-length SARS-CoV-2 S gene (GenBank: NC_045512.2) was synthesized by Genscript. as human codon-optimized cDNAs ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339, GenScript) was added ...
-
bioRxiv - Immunology 2022Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into the pCEP4 mammalian expression vector (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 µM the hemichannel inhibitor peptide TAT-Gap19 (YGRKKRRQRRRKQIEIKKFK, synthetized by Genscript). Slices in water were used as control for CBX and TAT Gap19 slices ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 ml of anti-His-tag affinity resin (GenScript Biotech, Piscataway, NJ, USA) was added into the concentrated culture medium and incubated at 4 °C overnight with rotation ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The solution was replaced with blocking buffer with appropriate dilutions of primary antibody (1:500 Rabbit anti-ChmC (Genscript, custom-generated) or 1:2,000 Rabbit anti-OmpA ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: DROP-CAR expression in B3Z cells was evaluated via labeling with a 1:200 dilution of biotinylated anti-Strep tag antibody (GenScript, A01737) binding the TMD-containing chain of the DROP-CAR ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated with an anti-Strep tag II antibody (THE™ NWSHPQFEK Tag Antibody, GenScript, USA, 1:1000 dilution) to detect Strep-tagged nsp1 and with an anti-GAPDH mouse-antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit polyclonal anti-AQP4ex generated against the peptide DSTEGRRDSLDLASC within the AQP4 C-terminus (1:1000; GenScript Biotech, Piscataway, NJ, USA), mouse monoclonal anti- OMP (1:300 ...
-
bioRxiv - Biophysics 2024Quote: ... a pGEX-4T-1 vector coding for SH downstream of a GST carrier protein and a thrombin cleavage site was acquired from GenScript (US). The plasmid was transformed into competent E ...
-
bioRxiv - Cell Biology 2024Quote: ... we purchased the gene-synthesized codon-optimized cytosol-exposed domain of BNIP3 (1-158aa) fused to a C-terminal GST-tag in a pFastBac-Dual vector from Genscript (RRID:Addgene_223764). Point mutants were introduced by in vitro mutagenesis to generate BNIP3 E44A/L47A/D49A/A50K/Q51A (5A ...
-
bioRxiv - Biochemistry 2024Quote: ... EYA3 and EYA3H79R were expressed with a C-terminal StrepII tag for detection using a Strep antibody (Genscript, A01732, 1:1000).
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...