Labshake search
Citations for GenScript :
701 - 750 of 812 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Neuroscience 2024Quote: ... Equal amounts of 10 μg protein lysate were loaded and separated on a 4-12% SurePAGETM gel (GenScript) and transferred to a polyvinylidene difluoride membrane (Millipore) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by denaturation at 95°C for 10 min and loading on 4-20% ExpressPlusTM PAGE gels (GenScript). The gel was allowed to run at 120V for 2 hours ...
-
bioRxiv - Immunology 2024Quote: ... heated at 70°C for 10 min before loading on a 4-20% bis-tris polyacrylamide gel (GenScript). In the case of purified protein 1 μg protein was loaded per condition and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... the samples were cooled and loaded onto a SurePAGE Bis-Tris 4-12% gel (GenScript, Piscataway, NJ, USA) with Protein Precision Plus dual color ladder (Bio-Rad laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... mice were intravenously injected with 0.1 mg (from a solution of 1mg/ml in PBS) of VP2121-130 (FHAGSLLVFM) or control E7 (RAHYNIVTF) peptide (GenScript, Piscataway, NJ, USA) into the tail vein.
-
bioRxiv - Microbiology 2021Quote: The cyc2 gene of Mariprofundus ferrooxydans PV-1 (accession no. AKN78226) was codon-optimized for expression in Escherichia coli and synthesized by Genscript (Piscataway, NJ, USA) with a C-terminal Strep-tag II (WSHPQFEK ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Also included were 100 AAVS1-targeting “safe harbor” guides taken from a separate CRISPR library.29 Each sequence was appended with the same universal prefix and suffix sequences and synthesized commercially in pooled format (GenScript, Supplementary Table 1).
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... The purified pigments were eluted with buffer A containing 0.5 ∼ 1 mg/mL 1D4 peptide (custom peptide synthesis by GenScript Japan Inc., Tokyo, Japan). To obtain pigments in solutions of various anions (SO42− ...
-
bioRxiv - Biochemistry 2024Quote: ... and cloned into a pGEX-6P-1 plasmid containing an N-terminal GST tag and a PreScission Protease cleavage site (GenScript, Piscataway, NJ, USA). The plasmid was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was quenched by SDS sample buffer and analyzed by 4-20% SDS-gel (GenScript, Piscataway, NJ, US). Fluorescent ubiquitin signals were imaged using Thermo iBright exposed for 750 ms.
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were recovered and 20 μg protein were separated on SurePAGE Bis-Tris 4-12% gradient gel following the manufacturer’s instructions (Genscript). A protein standards ladder (BioRad #1610374 ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Biochemistry 2024Quote: Codon-optimized RdRp and VPg genes of HuNoV GII.4 Sydney strain (GenBank: AFV08794.1) were synthesized and cloned in the pET28a vector for bacterial expression by Genscript U.S.A ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant obtained after centrifugation of lysate for 20 min at 10,000 rpm at 4°C was loaded onto anti-DYKDDDDK G1 affinity resin (GenScript) equilibrated with buffer A ...
-
bioRxiv - Microbiology 2024Quote: Supernatants and eluted samples were run on 4-12% SurePAGE™ Bis-Tris Gels (M00652, M00653, or M00654, GenScript), followed by wet transfer to Immobilon-P polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... Then the slices were incubated overnight at 4°C with rabbit polyclonal anti-AQP4 (GenScript Biotech, Piscataway, NJ, USA) diluted 1:2000 in the blocking buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... (NM_005855.4, H-pSL056), RAMP2 (NM_005854.3, H-pSL042) and RAMP3 (NM_005856.3, H-pSL043) were purchased from Genscript (Piscataway, NJ, USA). The DNA construct of the calcitonin receptor C-terminally fused with NanoLuc luciferase [22] (Nluc_FL_CTR (H-pSL054) ...
-
bioRxiv - Cell Biology 2024Quote: ... UK). AFF3ir-ORF2 (Cat. No. C0302HL300-4) and AFF3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (NJ, USA). GAPDH (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... binding sites of bta-miRNA-16a within the 3’UTR of the bovine Furin were synthesized by a commercial provider (GenScript USA Inc). Briefly ...