Labshake search
Citations for GenScript :
451 - 500 of 812 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... SDS-PAGE analyses were performed using 4-12% SurePAGE precast mini polyacrylamide gels (Genscript), and gel images were captured using the FUSION FX7 Spectra multispectral imaging system (Vilber).
-
bioRxiv - Genetics 2024Quote: ... samples were boiled then run on Surepage 4-12% Bis-Tris gels (#M00653, GenScript). Samples were then transferred onto 0.45 um nitrocellulose membranes in Tris-Glycine transfer buffer (25 mM Tris ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was eluted using 20 column columns purification buffer supplemented with 1 μM DYKDDDDK FLAG peptide (Genscript). Affinity purification of the TSEN-STREP construct was carried out using the STREP tag carried by the TSEN2 subunit ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell adhesion was enabled in all hydrogel groups through incorporation of either 1 mM RGD peptide (GCGYGRGDSPG, Genscript) or 2 μM thiolated Fn fragments (Fn9*10 or Fn4G) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were incubated for 1 hr at RT with horseradish peroxidase-conjugated anti-rabbit IgG (GenScript, A00098) or anti-mouse IgG (Pronteintech ...
-
bioRxiv - Microbiology 2021Quote: ... The left and right homology donor templates and the P4::gRNA constructs (Table 1) were synthesized by GenScript and inserted into the NheI and PvuII sites of pTMS001 generating pTMS007 and pTMS008 ...
-
bioRxiv - Immunology 2020Quote: Renilla luciferease fusion protein constructs were synthesized for the Fel d 1 component of cat allergen by GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... and the DABCYLGlu-EDANS labelled peptides encompassing the different cleavage sites (SI Table 1) were purchased from Genscript. Reactions were performed at room temperature in black 384-well polystyrene low volume plates (CELLSTAR-Greiner Bio-One # 784476 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA encoding TeNT-LC-HN (residues 1-870) and TeNT-HC were synthesized by GenScript (Piscataway, NJ). A thrombin protease cleavage site was inserted between I448 and A457 in both TeNT-LC-HN and chTeNT-LC-HN ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Cell Biology 2023Quote: ... The pGEX-6P-1-GST-OSBP(377-807) and pET28(+)-ORP2(49-480) plasmids were purchased from Genscript. The pET22b_His6_STARD1(66-284 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were subsequently washed with PBS and stained with α-camelid VHH antibodies (1:100, clone 96A3F5, Genscript) in 200 µl Cell Staining buffer for 30 min at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Cell Biology 2023Quote: ... coli were generated through custom synthesis and subcloned into an expression backbone (pETDuet-1) by Genscript (Piscataway, USA), as has been previously reported110.
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then pulsed with 20μg/ml OVA323–339 peptide (GenScript, Piscataway, NJ, Cat. No. RP10610-1) for 2 hours at 37℃ and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Microbiology 2024Quote: ... The pilA ACICU negative and αβ-loop mutants (sequences available in Supplementary Table 1) were synthesized by Genscript and ligated into pUCP20GM (33 ...
-
bioRxiv - Neuroscience 2024Quote: ... Tween20) for 1h and probed with the following primary antibodies: rabbit anti-DYKDDDDK-tag (1:2000, GenScript, #A00170) and mouse anti-actin (1:1000 ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligand stimulation by 50 ng.mL-1 of either Human VEGF165a or PLGF1 (Genscript #Z02689, RnD #264-PGB-010) for 0 min ...
-
bioRxiv - Microbiology 2021Quote: Both wild type and edited MARV NP 3’UTR coding sequences were synthesized by Genscript (Piscataway, NJ). For amplifying the remaining MARV UTRs purified total RNA from MARV infected THP1 cells at 24 hours post infection was used for cDNA synthesis ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 12 μl were resolved on precast ExpressPlus 4-12% gradient gel (GenScript #M41212). Proteins were electroblotted to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli codon-optimized 10xHis- PPEP-4 (lacking the signal peptide) construct was ordered from GenScript. The pET-16b 10xHis-PPEP-4 plasmid was transformed to E ...
-
bioRxiv - Neuroscience 2023Quote: ... 10Lμg of tissue lysates were resolved on a 4–12% Bris-Tris gel (M00668, GenScript) and transferred onto a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total cellular proteins were separated in 4-12% YoungPAGE Bis-Tris gels (GenScript, Nanjing, China) or 10% gels using One-Step PAGE Gel Fast Preparation Kit (Vazyme) ...
-
bioRxiv - Microbiology 2024Quote: ... the enriched proteins were separated on a gradient gel (GenScript, 4–20% precast polyacrylamide gel) at 120V for 5∼10 min ...
-
bioRxiv - Biochemistry 2024Quote: Pull down samples were then run on a 4-12% Bis-Tris denaturing gel (GenScript), then analyzed by Western blotting ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Evolutionary Biology 2020Quote: ... the primers g11S/g11AS covering target site sequence 11 (Figure 1A; Supplementary table 1) were synthesized by Genscript (www.genscript.com.cn) and combined by annealing ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used in the study were mouse anti-FLAG (1:1000; Cat. No. A00187-200, Genscript, NJ, USA), chicken anti-GFP (1:2000 ...
-
bioRxiv - Biochemistry 2021Quote: 1 µg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized fom Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Biochemistry 2022Quote: The genes of the human AC isoforms 1 – 9 cloned into the expression plasmid pcDNA3.1+/C-(K)-DYK were purchased from GenScript and contained a C-terminal flag-tag ...
-
bioRxiv - Microbiology 2022Quote: ... The protein was then eluted with 1 CV of FLAG resin buffer supplemented with 0.2 mg/mL FLAG peptide (Genscript) after incubating with the elution buffer for 5 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting supernatant was then loaded onto a gravity column with 1 mL α-FLAG G1 affinity resin (Genscript), and the flow through was passed through the column four more times ...
-
bioRxiv - Molecular Biology 2022Quote: ... a complete codon-optimized Omicron variant BA.1 spike was synthesized and inserted into pcDNA3.1 expression vector by Genscript. The clone includes the following amino acid differences from the Wuhan strain ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding human ACE2 (1-615) with a 6xHis tag at C terminus was synthesized by Genscript and cloned to the vector pCMV-IRES-puro ...
-
bioRxiv - Biochemistry 2021Quote: ... at 25 °C. The peptides except for the H3.3 (a.a. 1–59) peptide were all purchased from GenScript (Nanjing). The H3.3 (a.a ...