Labshake search
Citations for GenScript :
601 - 650 of 803 citations for Recombinant Human CD3E & CD3D His & Flag tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... washed and incubated with 0.1 μM anti-HA-FITC antibody and 0.1 μM anti-FLAG-iFluor 647 antibody (GenScript, Nanjing, China) for 15 min in dark ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Immunology 2019Quote: Human lipo-IFNα1 (152-189) peptide was synthesized by GenScript (Piscataway, N.J.). Lipo refers to conjugation with the lipid moiety ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Cell Biology 2022Quote: ... human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA), full-length human NSF fused to His6 in pET28 was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA). The rabbit polyclonal anti-CSP antibody (affinity-purified with the immunogen directed towards the amino acids 182-198 of rat CSP) ...
-
bioRxiv - Immunology 2022Quote: Residues 18-615 of human ACE2 (UniProtKB - Q9BYF1) were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Codon-optimized cDNAs for human SLC1A2 and SLC1A3 were obtained from Genscript and cloned in pTO vector with or without a N-terminal Strep-HA tag.
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Biochemistry 2021Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... the full-length cDNA of human McIdas was obtained by GenScript (OHu00715) and cloned with an N-terminal GFP tag into the EcoRI/XhoI restriction sites of the pENTR1AminusCmR vector ...
-
bioRxiv - Microbiology 2020Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human pre-pro-OCN cDNA cloned into pcDNA3 was purchased from GenScript. Each construct was used as PCR template for amplification and to introduce EcoRI and AgeI cloning sites and cloned in pIRES2-EGFP-V5 plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Site-directed mutagenesis to create human KCNH2 variants was completed by Genscript Biotech (Piscataway ...
-
bioRxiv - Immunology 2020Quote: The cDNA of the human CR3022 Fab fragment was synthesized by GenScript based on its previously reported sequence (31) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human NRP1 (HNPR1) cloned into pCS2+ was purchased from GenScript (Piscataway, NJ). All expression constructs were confirmed by sequencing and Western blot analysis (see below) ...
-
bioRxiv - Molecular Biology 2022Quote: The cDNA encoding wildtype human MRP4 was obtained from GenScript (CloneID: OHu17173) and cloned into a donor plasmid based on the pHTBV1.1 vector73 to generate a construct featuring full-length MRP4 with a C-terminal HRV 3C-cleavable mVenus-tag linked in tandem to a Twin-Strep-tag and a 6xHis-tag ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biophysics 2022Quote: ... Human TRPV4 constructs in a pcDNA3.1 vector were commercially obtained from GenScript. Expression plasmids encoding for the isolated intrinsically disordered region (IDR) ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific CD4+ and CD8+ T cell responses in NHP PBMCs were assessed by flow cytometry using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Briefly ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids pML107 11 or PAEF5 12 carrying gRNA were co-transformed with 200bp DNA repair recombinant donor sequences carrying telomeric repeats seeds (Genscript Biotech Netherlands) (Figure Supp 1A).
-
bioRxiv - Developmental Biology 2022Quote: ... The protein was eluted using elution buffer (50mM Tris-HCL,7.4, 100mM NaCl, 1mM EGTA, Flag peptide (GenScript, 300 μg/ml). The isolated proteins were then prepared for mass spectrometry using an in-solution protein digestion kit (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Molecular Biology 2022Quote: ... N-terminal 6xHis-Flag-tagged SUMO2 was cloned into BamH1 and Xho1 restriction sites of pcDNA5/FRT/TO plasmid by gene synthesis (GenScript Biotech). All primers used for site-directed mutagenesis are listed in supplementary table 1.
-
bioRxiv - Microbiology 2023Quote: ... The harvested cell pellets were analysed by SDS-PAGE and probed by western blot with an anti-Flag antibody (Genscript A01868).
-
bioRxiv - Molecular Biology 2023Quote: ... the beads were washed thoroughly with the IP buffer and the bound proteins were eluted with 200 μg/ml Flag (DYKDDDDK) peptide (GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was cleared by centrifugation at 20,000 × g for 35 mins and loaded onto a gravity-flow column to incubate with anti-FLAG affinity resin (GenScript Biotech). The resin was washed with 15 column volumes of Wash Buffer containing 20 mM of HEPES (pH 7.4) ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then eluted with a single wash of gel filtration buffer supplemented with 150 μg/mL 3x-Flag peptide (Genscript cat. RP21087) and 20 μM GppNHP ...
-
bioRxiv - Immunology 2023Quote: ... Insoluble material was removed by centrifugation at 30,000 × g for 30 min and the supernatant was incubated with anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ). After that ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).