Labshake search
Citations for GenScript :
5851 - 5900 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... the 136 bp inserts were made by gene synthesis (GenScript, Nanjing, China). The SacI-BglII-lined inserts were designed to contain two canonical ChoREs (CACGTGatataCACGTG ...
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Peptide ligands were custom synthesized by Genscript (Piscataway, NJ) at greater than 95% purity ...
-
bioRxiv - Systems Biology 2019Quote: ... All these regulatory elements were assembled using gene synthesis (GenScript) and 40 nucleotides of sequence homology to the insertion sites in the vector backbone (pESC-LEU ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... USA) with GatewayTM compatible attL1 and attL2 attachment sites (S4 and S8 Tables) and provided in pMS (Genscript).
-
bioRxiv - Evolutionary Biology 2019Quote: ... AtTCP18 and the AtTCP chimeras were gene synthesized by Genscript (New Jersey, USA) with GatewayTM compatible attL1 and attL2 attachment sites (S4 and S8 Tables ...
-
bioRxiv - Genomics 2019Quote: ... Protein was generated by GenScript (Piscataway, NJ) and purified to >80% purity ...
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Immunology 2019Quote: Peptides (Table 1) and HLA-A*11:01-restricted KRAS G12V8-16 (VVGAVGVGK) as positive peptide were synthesized from GenScript (Nanjing, China), with purity greater than 98% by mass spectroscopy ...
-
bioRxiv - Molecular Biology 2019Quote: ... was commercially synthesized (GenScript) and inserted into 13S-R (addgene # 48328 ...
-
bioRxiv - Microbiology 2019Quote: ... the Leo CDS without the signal sequence (67 to 564-bp of ACA1_074730) was codon optimized (GenScript) and cloned into pMAL-p2x vector ...
-
bioRxiv - Microbiology 2019Quote: ... was prepared by codon optimization (76 to 330-bp coding region of ACA1_377670) (GenScript, Piscataway, NJ). It was cloned into pGEX-6p-1 (GE Healthcare Life Sciences ...
-
bioRxiv - Immunology 2019Quote: ... We also stimulated 106 splenocytes per well with custom synthesized HBV peptides (Genscript) in the presence of 1X Brefeldin A (BioLegend ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Neuroscience 2019Quote: ... Equal volumes of supernatants and pellets were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis on 8-16% Bis-Tris gels (Genscript) that subsequently were stained with Coomassie blue R-250 (Supplementary fig ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and Solanum lycopersicum flavanone 3-hydroxylase (SlF3H) were optimized and synthesized by GenScript (Nanjing, China). Genes encoding Yarrowia lipolytica pentafunctional arom protein (YlARO1) ...
-
bioRxiv - Genetics 2019Quote: ... or K4me3 (GenScript). Reactions were performed at 30°C in Clr4 Reaction Buffer (100-120 mM Tris pH 8.5 ...
-
bioRxiv - Genetics 2019Quote: ... or K4me3K9me3 modifications (GenScript) was use as probe ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Microbiology 2019Quote: ... DNA sequencing was performed by Genscript or Genewiz.
-
bioRxiv - Biochemistry 2019Quote: ... or from GenScript. C-FITC-labeled PSMα3 was purchased from GL Biochem ...
-
bioRxiv - Cell Biology 2019Quote: K124 mAbs were produced by Genscript (genscript.com, Piscataway, NJ, USA) by immunizing Balb/c mice with synthetic peptides targeting N-terminal and C-terminal regions of equine K124 (gene ID ...
-
bioRxiv - Cell Biology 2019Quote: ... All gene synthesis and cloning were performed by Genscript (genscript.com). Digoxigenin (DIG)-labeled riboprobes were synthesized from T7 (for antisense probe synthesis ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal antibody used to purify γ-TuRC from Xenopus egg extract was generated against a purified γ-tubulin peptide (amino acids 412-451) through a commercial vendor (Genscript). The presence of γ-TuRC during its purification was tracked via Western blotting using the GTU88 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... The GII.4 Sydney 2012 variant specific-mAbs (1C10, 6E6, 17A5, and 18G12) were developed from mice immunized with RockvilleD1 strain VLP (GenScript, NJ, USA). HBGA-blocking assays were performed using mutant and wild-type VLPs ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Bioengineering 2019Quote: ... were gene synthesized by GenScript; (2 ...
-
bioRxiv - Bioengineering 2019Quote: ... The first three fragments were generated using commercial gene synthesis (gBLOCK by IDT® and GenScript). The 3xP3-eGFP fragment was amplified from a previously described plasmid harboring the 3xP3 promoter and coding sequence of eGFP (AddGene #111083 and 100705 ...
-
bioRxiv - Microbiology 2019Quote: ... and VP24 coding sequences (based on accession number KX371887) were synthesized by Genscript. The synthesized open reading frames were cloned into a pCAGGS expression vector with a FLAG-tag at the N-terminus of each coding sequence ...
-
bioRxiv - Developmental Biology 2019Quote: The 5′-regulatory region of human VEGFC gene (NG_034216.1) encompassing 2274 nucleotides (−1 to −2274 in relation to ATG, Figure 1) was synthesized by GenScript. This fragment was then used as a template for deletion of either the proximal (nt −623 to −603 ...
-
bioRxiv - Immunology 2019Quote: ... was added to wells either alone or with CGRP (1, 10, 100 nM, GenScript) and incubated for 72 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Biophysics 2019Quote: ... These DNAs were synthesized by Genscript Inc ...
-
bioRxiv - Pathology 2019Quote: ... The samples were loaded onto a 12% (vol/vol) SDS/PAGE gel and target proteins were detected using a polyclonal anti-GFP antibody (GenScript, USA) or a monoclonal anti-FLAG (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... coli was obtained from GenScript. CLASP2 ORF was subcloned into the EcoRI and NdeI restriction sites of the expression vector pPR-IBA2 (IBA LifeSciences ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting PCR products were analyzed by agarose gel electrophoresis and DNA sequencing (GenScript Biotech Corp., Nanjing, China).
-
bioRxiv - Bioengineering 2019Quote: All oligonucleotides were synthesized from GenScript (Nanjing, China) and listed in Table 3 ...
-
bioRxiv - Bioengineering 2019Quote: ... DNA of the mCherry expression cassette was synthesized from GenScript (Nanjing, China) and used for constructing the donor DNA of the pRep-cas3 plasmid (Table 2).
-
bioRxiv - Bioengineering 2019Quote: ... a DNA block composed of the leader sequence of the chromosomal CRISPR2 as a promoter and two CRISPR repeats spaced by two BsaI restriction sequences in opposite orientation was synthesized from GenScript (Nanjing, China), and used as a template for PCR amplification with the primer pair of L2R-XbaI-F/L2R-EcoRI-R (Table 3) ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-HCV NS4A (Genscript custom (Horner et al., 2011)) ...
-
bioRxiv - Genetics 2019Quote: We cloned gRNA libraries purchased from CustomArray (now GenScript) for each of 5 genomic loci (Fig S3) ...
-
bioRxiv - Biophysics 2019Quote: ... TRPV2 was eluted with Wash Buffer containing 0.006% DMNG and 3 mg/ml 1D4 peptide (GenScript USA) and subjected to size-exclusion chromatography using a Superose 6 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: RP3: ({RRASL}3) and RP3C: ({RRASL}3C) were ordered and custom synthesized from GenScript (New Jersey, USA) at ≥95% purity ...
-
bioRxiv - Microbiology 2019Quote: ... and EMC4 cDNA (GenScript; clone OHu00964) were PCR amplified using tgtggtggaattctgcagataccATGGCGAAGGTCTCAGA / CGGCCGCCACTGTGCTGGATTTACTTATCGTCGTCATCCTTGTAATCAGACTGGGTGATC and tgtggtggaattctgcagataccATGACGGCCCAGGGG / CGGCCGCCACTGTGCTGGATTTACTTATCGTCGTCATCCTTGTAATCCAAAAGCAGTCCT ...
-
bioRxiv - Microbiology 2019Quote: EMC2 (GenScript; clone OHu30604) and EMC4 cDNA (GenScript ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with Biotin-Protein L (Genscript) followed by fluorescently-conjugated streptavidin.
-
bioRxiv - Bioengineering 2019Quote: ... Absolute concentrations of Rituximab were calculated by comparison with a calibration curve generated from a dilution series of human IgG (A01006, Genscript, New Jersey, NJ, USA). Regeneration of biosensor tips between measurements was performed in 10 mM glycine pH 1.7 ...