Labshake search
Citations for Takara Bio :
201 - 250 of 847 citations for Toll Like Receptor 5 TLR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 units/μl of Takara Ex Taq™ (Takara Bio Inc.). Each multiplex PCR amplification was conducted as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... first-strand cDNA was synthesized with 5’ RACE CDE Primer A (Clontech) (5’-RACE-Ready cDNA samples) ...
-
bioRxiv - Microbiology 2023Quote: ... pGP (# 6161) and pDON-5 Neo DNA (# 3657) were purchased from Takara Bio Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Antibodies used were: anti-dsRed (Clontech, 632496) 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GFP antibody (JL8) was from Clontech, and anti-Cdc37 antibody (E-4 ...
-
bioRxiv - Genetics 2023Quote: ... or mouse α-GFP antibody (632381, Takara) were diluted 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’RACE reaction was performed according to the kit manufacturer’s instructions (Clontech / Ozyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... The following primary antibodies were used in this study: Living colors DsRed Polyclonal antibody (Rabbit, 1:300, Takara Bio #632496); FITC Anti-mouse Ki67 (1:100 ...