Labshake search
Citations for Takara Bio :
1 - 50 of 847 citations for Toll Like Receptor 5 TLR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... with the modification that Ecotropic Receptor Booster (Takara, #631471) was added to the cells as suggested by the manufacturer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Neuroscience 2023Quote: ... Constructs containing point-mutated ARE-like sequences were prepared using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Because an ARE half-site can function alone to confer androgen inducibility (Pihlajamaa et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... was similarly constructed with the leptin receptor promoter controlling expression of mCherry (Clontech) without ChR2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
bioRxiv - Plant Biology 2019Quote: The full-length cDNA of NaERF2-like with two HA flags was cloned into pCAMBIA1301 vector after 35S promoter via in-fusion technique (Clontech). N ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Bioengineering 2024Quote: ... and the receptor- or payload-encoding viral expression plasmids (2.0 μg) into Lx293T cells (Clontech) in 6-well plates with Lipofectamine 3000 (Thermo Fisher L3000001) ...
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Cell Biology 2021Quote: ... For iPSC-O differentiation to hepatocyte-like cells (HLC-O): Hepatic differentiation of iPSC-O was performed by Cellartis Hepatocyte Differentiation Kit (Y30050, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... Each half-site of the responsible ERE-like sequence was mutated into a HindIII recognition site using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Transcriptional activity assays with these constructs were done as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... Insoluble material was removed by centrifugation and the supernatant containing the receptor was rotated with Talon resin (Takara) overnight ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected either with GluK3EM or co-tansfected with Wild type/mutant receptors along with GFP expressing plasmid (2 µg/dish) using Xfect reagent (Clontech). Currents were recorded from medium sized cells expressing a moderate level of fluorescence from either the fused EGFP in case of GluK3EM or co-expressed EGFP and having a capacitance of ∼5-6 pF at 48-60 hours post transfection ...
-
bioRxiv - Immunology 2020Quote: ... The entirety of each of the annotated intracellular domains was ordered as a separate gene fragment (Integrated DNA Technologies) and each complete receptor was cloned into pHR lentiviral expression vector (Clontech). Each region of the protein was amplified using PCR and fragments were combined using Gibson assembly.
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells and hippocampal neurons were transfected with plasmids encoding FM4 recombinant receptors for 15 h and then treated with 2 μM DD-Solubilizer (TakaraBio/Clontech) to induce the release of the receptors from the ER into the secretory trafficking ...
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified fragments required to generate the chimeric receptor were combined with a linearized pCS2+ backbone and annealed using an In-Fusion kit (Takara Bio, 638947). The resulting plasmids were transformed into Top10 chemically competent cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... bone sections were blocked in 5% bovine serum albumin (BSA) for 1 hour at room temperature and incubated with primary antibody to osteocalcin (Takara, M173) at 4°C overnight ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’RACE was carried out using a 5’ Full RACE Core Set (Takara Bio). The first PCR was performed using the single strand cDNAs concatenated by T4 RNA ligase and primers S1 (5’-TTC TAT ACC ATC GTC TAC CCG CTG AGC TTC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2021Quote: The 5′ RACE analysis was conducted using the 5′ -Full RACE Core Set (Takara), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pEco (Takara, #PT3749-5). Cells transduced with the retrovirus were sorted for EGFP positive by flow cytometry ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Cell Biology 2024Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ ends of the viral genome were analyzed by 5’-Full RACE Core Set (TaKaRa) and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega ...
-
bioRxiv - Genetics 2022Quote: The 5’end of the cloned fragment was amplified with a 5’RACE kit (Takara). The 5’RACE adaptor in the kit was used to evaluate the mRNA ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...