Labshake search
Citations for Takara Bio :
201 - 250 of 830 citations for SARS CoV 2 Spike Glycoprotein S1 RBD His Tag CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... The protein library was purified using a His-Tagged 96-well plate cartridge (Clontech) and buffer exchanged into 50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... with an N-terminal GFP tag using the In-Fusion HD Cloning kit (Takara).
-
bioRxiv - Microbiology 2020Quote: ... The cDNA fused to a C-terminal HA tag was subcloned into pQXCIH (Clontech) in between the NotI and PacI sites to obtain the pQXCIH-TMPRRS2-HA vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was generating by replacing a V5 tag with an eGFP or DsRed (Clontech) tag from pcDNA3.1-nV5-DEST vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA libraries were prepared using a SMARTer ThruPLEX Tag-seq Kit (Takara Bio), and the samples were sequenced on an Illumina HiSeq1500 system.
-
bioRxiv - Microbiology 2020Quote: ... HSP70-F2/R2 primers (Table S1) and ligated into pBS-SK+ using the In-fusion HD Cloning kit (Clontech, Beijing, China), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Plant Biology 2020Quote: ... The RAV1 motif enriched promoter sequence of each of the gene (Table S1) was cloned in pAbAi bait vector (Clontech, USA) in the upstream of Aureobasidine A ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of Arfs were amplified by PCR (primers listed in Suppl. Table S1) and inserted into the pQXCIP plasmid (Takara Bio) using the AgeI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Microbiology 2022Quote: ... CoV-229E sequences were obtained as gBlocks from IDT and subcloned into these plasmids using InFusion cloning (Takara).
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Cell Biology 2019Quote: ... or mKate2 (Shcherbo et al., 2009) tags by homologous recombination via In-fusion Cloning (TaKaRa). 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio). pCI-SEP-NRI was a gift from Robert Malinow (Addgene plasmid # 23999 ...
-
bioRxiv - Cell Biology 2020Quote: ... Importin α with an N-terminal FLAG tag was cloned into pLVX-TetOne-Puro (Clontech) to generate stable cell lines ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2023Quote: ... truncatula A17 using the primers MtU6.6_prom_InF_F1 and MtU6.6_prom_InF_R along with the guide cassette fragment amplified from pKSE401_RR using the primers pKSE401_empty_InF_F2 and pKSE401_InF_R2 (Table S1) and the amplified fragments were assembled into the HindIII digested pKSE401_RR vector backbone using In-Fusion cloning (Takara Bio, Kusatsu, Japan).
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... the fragment were ligated into the Xho I and Bam HI sites of pEGFP-N3 (Clontech), creating Aβ fused in frame to the N-terminus of GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAcGFP-His-MAP2C without AcGFP was amplified and Dendra2 was amplified from pDendra2-C vector (Takara). Dendra2 was inserted into where AcGFP was by In-Fusion cloning kit ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... coding sequences were amplified by PCR from zebrafish cDNA using specific primers (Table S1) and subcloned into mCherry-C1 vector (Clontech, Mountain View, CA). hVPS4A in pEGFP-C1 was previously described in Elia et ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA from each juvenile (as described in Methods S1) was converted to cDNA using PrimeScript RT-PCR Kit (Takara Bio, Shiga, Japan). The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The genes were amplified with [AgApiTpCold_F and R] and [Agr35256-2_F and R] primer sets (Supplemental Table S1) and cloned into the NdeI/XbaI sites of the pCold ProS2 vector (Takara Bio, Kusatsu, Japan). The resulting plasmid was transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... Ank only) rat Shank3 with a C-terminal mRFP-tag were generated in pmRFP-N3 (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (Univ ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sample was directly lysed in 4 μL of lysis buffer (including 0.2 μL of 1:1000 diluted external RNA controls consortium (ERCC) spike-in) and immediately reverse-transcribed using the PrimeScriptTM II Reverse Transcriptase (Takara, Cat# 2690A), and the cDNA library was constructed as the published Smart-seq2 method ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Plant Biology 2019Quote: ... strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech, Saint Germain-en-Laye, France). The 3’ ends were amplified using forward internal and polyA-anchored LD primers (Table S1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting GST-S-LacI fusion sequence was then amplified by PCR using primers eo1211 and eo1212 (Supplementary Table S1) and inserted between the NdeI and HindIII sites in the pCold II vector (Takara Bio, Shiga, Japan, #3362) by the In-Fusion reaction ...
-
bioRxiv - Microbiology 2019Quote: ... The NusA tag of GfsB was cleaved with a HRV 3C protease at 4°C (Takara Bio) and removed by Ni-agarose ...
-
bioRxiv - Genetics 2020Quote: ... in frame with Myc and Flag tag by In-Fusion HD EcoDry Cloning Plus System (Takara Bio). In order to insert a poly histidine tag for protein expression and purification ...
-
bioRxiv - Systems Biology 2023Quote: ... sSH2 domains were immediately purified by the N-terminal His6 tag with TALON® resin (Takara Bio) using a gravity column (detailed purification method in the Supporting Methods 1) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV2 Mpro and C300S Mpro were purified first by affinity chromatography using TALON™ cobalt-based affinity Resin (Takara Bio). The His6-tag was cleaved off by PreScission protease and the resulting authentic 306 amino acid Mpro (see Figure S1A in supplemental material ...