Labshake search
Citations for Takara Bio :
51 - 100 of 255 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were co-transfected with pEGFP-F (Clontech), pDsRed monomer-F (Clontech) ...
-
bioRxiv - Plant Biology 2022Quote: ... These plasmids were transformed into Saccharomyces cerevisiae strain AH109 (Clontech). At least 3 independent yeast transformants were checked for each pairwise interaction according to (Cuellar et al. ...
-
bioRxiv - Microbiology 2020Quote: ... BL21 strains transformed with GroEL-GroES chaperones (Takara Bio USA) were used for recombinant protein preparations ...
-
bioRxiv - Cell Biology 2020Quote: ... coli strain C43(DE3) using a pColdII vector (Takara Bio) (pColdII-His-GST-TEVsite-H1.8) ...
-
bioRxiv - Plant Biology 2022Quote: ... and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech, USA) under selection with SD/-Trp ...
-
bioRxiv - Biochemistry 2022Quote: ... The yeast strain (Saccharomyces cerevisiae) used is Y2HGold (Clontech Laboratories). The bacteria were grown in Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2023Quote: ... vectors were transformed into the Saccharomyces cerevisiae AH109 strain (Clontech). Transformations with empty vectors were used as negative controls ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant constructs were transformed into Y1H gold strain (Takara). The transformed yeast strains were grown on SD/-Leu and SD/-Leu/AureobasidinA media (Takara ...
-
bioRxiv - Plant Biology 2023Quote: Yeast two-hybrid assays were performed using strain AH109 (Takara). Vectors pGADT7 and pGBKT7 were sequentially transformed into this strain ...
-
bioRxiv - Microbiology 2021Quote: ... Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA, Mountain View, CA, USA) using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilised metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilized metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Glycopeptides were treated with PNGase F (Takara Bio, Shiga, Japan) in 50 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2020Quote: ... These constructs were transformed into Saccharomyces cerevisiae strain Y2HGold (Clontech, US) applying the LiAc method ...
-
bioRxiv - Plant Biology 2021Quote: ... inserted into the yeast strain Y2H (Clontech, Mountain View, CA, USA), which next transferred to the SD/-Trp medium ...
-
bioRxiv - Molecular Biology 2022Quote: ... and transformed in the AH109 and Y187 haploid yeast strains (Clontech). AH109 and Y187 cells were transformed with Gal4 DNA binding domain (GBD ...
-
bioRxiv - Genetics 2022Quote: ... and the constructs were co-transformed into yeast strain Y2HGold (Takara). Co-transformants were selected on SD plates containing minimal supplements without leucine and tryptophan (SD/-Leu/-Trp ...
-
bioRxiv - Plant Biology 2019Quote: ... These constructs were individually transformed into AH109 yeast strain (Takara Bio) and the self-activation ability was analyzed ...
-
bioRxiv - Cell Biology 2020Quote: ... cerevisiae strain HF7c (Clontech Laboratories, Takara Bio USA, Mountain View, CA), containing the reporters His3 and LacZ under the control of a GAL4 upstream activation sequence ...
-
bioRxiv - Microbiology 2023Quote: ... Escherichia coli strains StellarTM (Takara bio, San Jose, CA, United States) were grown at 37°C in LB broth (Difco ...
-
bioRxiv - Plant Biology 2024Quote: ... Yeast two-hybrid assays were performed using yeast strain AH109 (Clontech) following standard procedures (Yeast Protocols Handbook PT3024-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae strain JOS003 using the Quick and Easy Transformation Mix (Clontech). JOS003 is a strain in which the one endogenous EIF4E gene has been replaced by homologous recombination with a KanMX4 cassette ...
-
bioRxiv - Microbiology 2024Quote: ... and simultaneously transformed to the Saccharomyces cerevisiae AH109 strain (Clontech, CA) as described above ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Developmental Biology 2020Quote: ... Prey and bait vectors were co-transformed into yeast strain Y2HGold (Clontech) and were grown on SD -Leu/-Trp plates at 30 °C for 3 days ...
-
bioRxiv - Plant Biology 2020Quote: ... pGBKT7 and pGADT7 clones were transformed into haploid yeast strain AH109 (Clontech) by electroporation and selected on SD-Trp-Leu medium ...
-
bioRxiv - Plant Biology 2021Quote: Cell viability assays were performed by using either Y2HGold yeast strains (Clontech) containing a pBridge bait vector or diploid yeast strains generated by mating a Y2HGold strain containing a bait vector with a Y187 strain (Clontech ...
-
bioRxiv - Plant Biology 2021Quote: ... Bait and prey vectors were co-transformed into AH109 yeast strains (Clontech) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Yeast (strain AH109) cotransformation was performed according to the Yeast Handbook (Clontech). An anti-HA (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae strain BJ5464 using protocol Yeastmaker™ Yeast Transformation System 2 (Clontech). The transformants were screened on yeast nitrogen base (YNB ...
-
bioRxiv - Neuroscience 2022Quote: ... The yeast strains AH109 and Y187 as a partner (both from Clontech) were used.
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Microbiology 2022Quote: ... Y2H Gold yeast strain is cultured in YPDA (TaKaRa Bio,Shiga, Japan). Escherichia coli strain DH5α is used to preserve the plasmids pRS426 ...
-
bioRxiv - Microbiology 2023Quote: ... Y2H Gold (pGADT7-PfGEXP15 RVxF) and Y187 (pGBKT7 constructs) yeast strains (Clontech) were mated on SD-LW media ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2019Quote: ... Pairwise combinations of vectors were co-transformed into the yeast strain Y187 (Clontech) and plated onto the same selective medium ...
-
bioRxiv - Cell Biology 2020Quote: ... The Y2H assays were performed in the Y2H Gold strain (PT4084-1, Takara 630489 ...
-
bioRxiv - Genetics 2019Quote: ... Pairs of plasmids were transformed into strain Y187 (Clontech, Mountain View, CA, USA) and liquid β-galactosidase assays were performed using an OMEGASTAR plate reader (BMG Labtech ...
-
bioRxiv - Plant Biology 2022Quote: ... Bait and prey constructs were co-transformed into the yeast strain Y2HGold (Clontech) using the Frozen-EZ Yeast Transformation II Kit (Zymo Research ...
-
bioRxiv - Microbiology 2019Quote: ... These constructs were amplified in the DH5 strain of E.coli (Takara, Dalian, China). Cells were seeded in 6-well plates at the concentration of 5 × 104 cells/well and cultured for 24 h before transfection ...
-
bioRxiv - Genetics 2021Quote: ... Saccharomyces cerevisiae strains AH109 Gold and Y187 (Clontech, MATCHMAKER GAL4 Two-Hybrid System) were transformed according to the classical protocol (42 ...
-
bioRxiv - Plant Biology 2022Quote: ... pairwise AD and BD were co-transformed into yeast strain Y2H gold (Clontech). Cells transformed with both plasmids were selected after growth 2 d at 30□ on synthetic dropout medium lacking leucine and tryptophan ...
-
bioRxiv - Plant Biology 2022Quote: All yeast constructs were transformed into the Saccharomyces cerevisiae Y2H Gold strain (Clontech) using Yeastmaker™ Yeast Transformation System 2 (Clontech) ...
-
bioRxiv - Plant Biology 2022Quote: The pGBKT7 and pGADT7 plasmids were co-transformed into yeast strain AH109 (Clontech) using the LiCl-PEG (polyethylene glycol ...
-
bioRxiv - Plant Biology 2022Quote: The yeast strain Y2HGold and the Matchmaker Gold Yeast Two-Hybrid System (Clontech) were used for the yeast two-hybrid assay ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... All experiments were performed in Y2HGold yeast strain as per the manufacturer’s protocol (Clontech). The plates and liquid cultures were grown in incubator at 30°C with agitation (200 rpm ...
-
bioRxiv - Plant Biology 2021Quote: pGBKT7-and pGADT7-based constructs were co-transformed into the Y2HGold yeast strain (Clontech) using Yeastmaker™ Yeast Transformation System 2 (Clontech ...