Labshake search
Citations for Takara Bio :
1 - 50 of 255 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Microbiology 2020Quote: ... digested spike backbone vectors (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Plant Biology 2021Quote: ... containing a pBridge bait vector or diploid yeast strains generated by mating a Y2HGold strain containing a bait vector with a Y187 strain (Clontech) containing the pGADT7 vector ...
-
bioRxiv - Cell Biology 2019Quote: ... cerevisiae strain AH109 (Clontech Laboratories Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... cerevisiae strain HF7c (Clontech Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain StellarTM (ClonTech), prior to isolation and transformation into COH1 GBS ...
-
bioRxiv - Microbiology 2023Quote: ... Gold strain yeasts (Clontech) carrying plasmids expressing DB-fused NS5 sequences were co-transformed using a standard lithium/acetate procedure with 10 ng of linearized pPC86 empty vector (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... pDsRed monomer-F (Clontech), or iRFP670 (kindly gifted from Prof ...
-
bioRxiv - Cell Biology 2020Quote: ... MC3T3-E1 and ATDC5 cells were infected with CRISPR lentivirus and selected with puromycin (4.5 μg/ml, Clontech) for 7 days ...
-
bioRxiv - Molecular Biology 2021Quote: ... Saccharomyces cerevisiae strain AH109 (Clontech) was co-transformed with GAL4 DNA-BD-fused IPMK and a human brain cDNA activation domain (AD ...
-
bioRxiv - Molecular Biology 2019Quote: Y2H budding yeast strain (Takara) was cultured with YEPD+adenine overnight at 30°C ...
-
bioRxiv - Microbiology 2020Quote: Saccharomyces cerevisiae strain AH109 (Clontech Laboratories Inc. ...
-
bioRxiv - Cell Biology 2023Quote: Saccharomyces cerevisiae strain AH109 (Clontech) was maintained on yeast extract/peptone/dextrose-agar plates ...
-
bioRxiv - Microbiology 2019Quote: ... choshinensis strain HPD31-SP3 (Takara Bio) carrying pNI-DsRed was grown in 2SYF medium (20.0 g/L fructose ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain BL21/pG-Tf2 (Takara). Cells were grown at 37°C in the presence of Ampicillin and Chloramphenicol until OD600 reached 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The Y2H Gold yeast strain (Clontech) was transformed with appropriate pGADT7 and pGBKT7 constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... cerevisiae strains Y2H gold (Clontech Laboratories). The representative transformants on SD -Leu ...
-
bioRxiv - Plant Biology 2021Quote: ... Escherichia coli strain BL21 (DE3) (Takara) was used for recombinant protein expression ...
-
bioRxiv - Pathology 2019Quote: ... cerevisiae strains Y187 and Y2HGold (Clontech) were used for yeast two hybrid assays ...
-
bioRxiv - Biochemistry 2020Quote: The Escherichia coli strain JM109 (TaKaRa) was used for plasmid DNA cloning ...
-
bioRxiv - Microbiology 2020Quote: ... The reporter Y2HGold yeast strain (Clontech) was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... cerevisiae strain PJ69-4A (Clontech, USA), which contains the lacZ gene from E ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Plant Biology 2021Quote: ... Haploid yeast strains Y2HGold and Y187 (Clontech) were transformed with pGBKT7 and pGADT7 constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Saccharomyces cerevisiae strain Y2H Gold (Takara) was used to co-transform the plasmids following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Escherichia coli strains Stellar™ (Takara bio) and Rosetta™ 2 (Novagen ...
-
bioRxiv - Microbiology 2022Quote: ... cerevisiae strain AH109 (Matchmaker 3 system, Clontech) was used ...
-
bioRxiv - Biochemistry 2021Quote: ... coli strain BL21/pG-Tf2 (Takara 9124), in the presence of Ampicillin (100 μM/mL ...
-
bioRxiv - Bioengineering 2022Quote: ... coli strain JM109 (Takara Biochemicals, Shiga, Japan) was used as the host for DNA manipulation and sensor strain construction ...
-
bioRxiv - Genetics 2022Quote: ... transformed into yeast strain Y187 (Takara Bio) and transformants were selected on medium lacking leucine ...
-
bioRxiv - Genetics 2022Quote: ... transformed into yeast strain Y2HGold (Takara Bio) and transformants were selected on medium lacking tryptophan ...
-
bioRxiv - Biochemistry 2022Quote: ... The yeast strain Y2H Gold (Clontech Laboratories) was first transformed with the bait vectors (i.e. ...
-
bioRxiv - Cell Biology 2023Quote: SseI gene was amplified from Salmonella typhimurium (STM) strain LT-2 strain using high fidelity DNA polymerase enzyme from TaKaRa and cloned in with N-terminal flag and HA tag in mammalian expression vector pcDNA3 flag HA Akt1 plasmid obtained from addgene(1477) ...
-
bioRxiv - Microbiology 2019Quote: ... coli strains HST08 Premium (Takara Bio, Shiga, Japan), DH5α (Cosmo Bio ...
-
bioRxiv - Microbiology 2021Quote: ... using the Y2H Gold yeast reporter strain (Clontech). The Seasf1 ...
-
bioRxiv - Plant Biology 2019Quote: ... The yeast strain Y2HGold (Clontech, Mountain View, CA) was first transformed with the bait vectors and subsequently with the prey vector pGADT7-M3Kα-KD and selected on SD medium lacking tryptophan and leucine ...
-
bioRxiv - Plant Biology 2022Quote: ... and introduced into the yeast strain AH109 (Clontech), which was then transformed with a pACT2 carrying cDNA expression library prepared from dark-grown Arabidopsis cell suspension (89) ...
-
bioRxiv - Microbiology 2022Quote: ... coli strain BL21(DE3)-pGro7/GroEL (Takara Bio) was grown in 500 mL of ZYP medium [47] (supplemented with 100 μg/mL ampicillin ...
-
bioRxiv - Cell Biology 2023Quote: ... coli strain BL21-competent cells (TaKaRa Bio, TKR9126). Colonies were inoculated into LB broth for starter cultures incubated at 37 °C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Escherichia coli strain HST08 (Takara Bio, Otsu, Japan) was used as the host for recombinant DNA manipulation ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μL Porcine Transmissible Gastroenteritis and Porcine Epidemic Diarrhea Vaccine (Strain WH-1R + Strain AJ1102-R, Wuhan Keqian Biological. Company, Ltd.) or 1 ng λDNA (3010, Takara, Japan) were suspended and mixed together using 1.5 mL of sample preservation medium (R503 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... transformed into the Saccharomyces cerevisiae Y187 strain (prey strain) was screened using the Matchmaker® Gold Yeast Two-Hybrid System (Takara Bio). For that purpose ...
-
bioRxiv - Synthetic Biology 2019Quote: The strains Y2HGOLD and Y187 were purchased from Clontech. pGAL4AD-x and pGAL4BD-y plasmids were purchased from Addgene (28246 and 28244 ...
-
bioRxiv - Plant Biology 2020Quote: ... which were used to transform yeast strain Y2HGold (Clontech) using the lithium acetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... Vectors were transformed into yeast strain Y2HGold (Clontech, Japan). Growth was determined as described in the Yeast Two-Hybrid System User Manual (Clontech ...
-
bioRxiv - Microbiology 2019Quote: ... coli K12 strain HST08 Premium (Takara Bio, Shiga, Japan) was used for cloning ...
-
bioRxiv - Molecular Biology 2022Quote: ... Vectors were transformed into yeast strain Y2HGold (Clontech, Japan). Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech ...
-
bioRxiv - Plant Biology 2022Quote: ... transformed into the Y187 strain (Clontech, Mountain View, California), and plated on SD/-Leu to select for positive transformants ...