Labshake search
Citations for Takara Bio :
401 - 450 of 893 citations for M CHERRY MRNA mCherry Fluorescent Protein coding mRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The expression construct coding for eGFP-NLS was produced from pEGFP-N1 (Takara Bio USA, Inc., Mountain View, CA, USA) accordingly ...
-
bioRxiv - Developmental Biology 2020Quote: The ERK-KTR-mCherry construct for transient expression was prepared by first inserting the coding sequence for ERK-KTR (Regot et al., 2014) into a CMV-driven mCitrine C1 expression vector (TaKaRa), and then replacing the fluorophore for mCherry ...
-
bioRxiv - Molecular Biology 2020Quote: ... the coding sequence for Map2 was inserted into the backbone of pEGFP-Tub (BD Biosciences Clontech, Franklin Lakes, NJ, USA) with restriction enzymes XhoI and BamHI after amplification from pDONR223-MAP240 (forward primer ...
-
bioRxiv - Plant Biology 2019Quote: ... The JAZ coding sequences were ligated into the multi-cloning site of the Y2H vector pB42AD (Clontech, Mountain View, CA) to generate N-terminal fusions to the B42 transcriptional activation domain ...
-
bioRxiv - Cell Biology 2019Quote: A Tmem98-AcGFP fusion construct was generated by cloning the Tmem98 coding sequence into the SmaI cut pAc-GFP-N2 vector (Clontech). TMEM98-AcGFP did not inhibit FRAT2 activity to a similar extent as TMEM98-FLAG (data not shown) ...
-
bioRxiv - Biophysics 2019Quote: ... and the full mNeonGreen coding sequence was inserted in its place using In-Fusion cloning (Takara Bio; Mountain View, CA). NG-Scarlet and NG-Cherry were created by deleting mRuby3 from NG-Ruby3 by inverse PCR and insertion of either mScarlet-I or mCherry using In-Fusion cloning (Takara Bio) ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... Tll or PntP1 coding region was amplified using the CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from a cDNA library and cloned into pcDNA™3.1/His expression vectors (Catalog #V38520 ...
-
bioRxiv - Cell Biology 2021Quote: ... The vimentin-null mEFs expressing vimentin are created by PCR amplification of the vimentin coding sequence using CloneAmp polymerase (Clontech) from pcDNA4-vimentin (provided by J ...
-
bioRxiv - Neuroscience 2021Quote: ... IGF1R-mEGFP was prepared by inserting the coding sequence of IGF1R (a gift from Dr. Inna Slutsky) into pEGFP-N1 (Clontech) containing the A206K monomeric mutation in EGFP and the CAG promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... Constructs coding for FRB (DmrA) and FKBP (DmrC) sequences were obtained from ARIAD Pharmaceuticals and are now available from Takara Bio Inc ...
-
bioRxiv - Plant Biology 2020Quote: ... Plasmids for the PARN activity assay were constructed by inserting the coding sequence of RRD1 or human PARN (hPARN) into the pHAT vector (Clontech). The hPARN sequence was derived from the GNP Human cDNA clone IRAK071M01 (RIKEN BioResource Research Center) ...
-
bioRxiv - Microbiology 2020Quote: ... Dengue NS5-GFP fusion construct was generated by inserting the dengue New Guinea C NS5 coding sequence from pDVW601 (44) into pACGFP1-N1 (Clontech) as previously described (20).
-
bioRxiv - Immunology 2021Quote: ... [50]) coding for Drosophila SPARC was used as a template for PCR amplification using Takara Ex Taq polymerase (Takara Biomedicals) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... a DNA fragment of the TkR86C coding region was amplified from cDNA from the Canton-S wild type strain by PCR (PrimeSTAR GXL, TaKaRa Clontech) with primers that had NotI and XbaI sites at 5’ and 3’ ends ...
-
bioRxiv - Plant Biology 2022Quote: ... The full-length and truncated coding regions of WL1 were amplified and cloned into the yeast expression vector pGADT7 (Clontech) to produce pGADT7-WL1 ...
-
bioRxiv - Molecular Biology 2022Quote: Rps29 5’UTR and coding region cDNAs were synthesised using SMART™ RACE cDNA Amplification Kit (Clontech Laboratories Inc. USA). PCR was performed using gene-specific primers (40S 5’ RACE R ...
-
bioRxiv - Molecular Biology 2019Quote: ... The N-terminal 3X-FLAG-tagged ThPOK expression plasmid was generated by cloning the ThPOK coding DNA sequence (CDS) in the backbone of pEGFPC-3 (Clontech) plasmid after replacing the CDS of EGFP with 3X-FLAG ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-026 was generated by subcloning a DNA fragment encoding an N-terminus FLAG-tagged mouse eIF2α coding sequence flanked by BamHI and EcoRI sites into the BglII and EcoRI sites of pLPCX (Clontech) using standard molecular biology methods ...
-
bioRxiv - Cell Biology 2021Quote: ... pLPCX-IRES-eGFP was generated by cloning a fusion PCRP consisting of the encephalomyocarditis virus internal ribosomal entry site (EMCV-IRES) upstream of the eGFP coding sequence flanked by EcoRI and NotI sites into the cognate sites of pLPCX (Clontech). A DNA gene block encoding the vaccinia virus Wisconsin strain K3L fused to the C-terminus of mNeonGreen by a GSGS linker and hosted into the expression vector pTwist Lenti SFFV puro WPRE was obtained commercially (Twist Bioscience) ...
-
bioRxiv - Biophysics 2020Quote: ... The peroxisome-targeting PEX3-mRFP-FKBP construct was a gift from Casper Hoogenraad (Utrecht University (53)).Constructs coding for FRB (DmrA) and FKBP (DmrC) sequences were obtained from ARIAD Pharmaceuticals and are now available from Takara Bio Inc ...
-
bioRxiv - Immunology 2022Quote: ... The pINDUCER20-EYFP-mCITED1 lentiviral construct was produced by amplifying the full-length murine CITED1 coding sequence from pCDNA3-Flag-mCITED1 and subcloning it into pEYFP-C1 (Takara/Clontech) in-frame with the EYFP coding sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... Constructs coding for FRB (DmrA) and FKBP (DmrC) sequences were obtained from ARIAD Pharmaceuticals and are now available from Takara Bio Inc ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Plant Biology 2022Quote: The coding sequence of ZmEREB57 was obtained and digested by EcoRI and BamHI and inserted into the pGADT7-AD vector (Clontech) containing the GAL4 active domain ...
-
bioRxiv - Plant Biology 2023Quote: The nucleotide sequence (around 500 bp long) specific to the NlCA coding region was cloned into the pMD 19-T vector (TAKARA). The double-stranded RNA was synthesized through PCR amplification by using the Mega script T7 High Yield RNA Transcription Kit (Vazyme ...
-
bioRxiv - Cancer Biology 2023Quote: ... The construct containing Y181G-coding point mutation was generated by inverse PCR of Zdhhc20WT plasmid using CloneAmp HiFi PCR Premix (Takara) and joining the ends of the PCR product using InFusion cloning.
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2019) upstream of an egfp coding sequence and an SV40 polyadenylation sequence using In-Fusion Snap Assembly master mixes (Takara). To prepare the injection mixtures ...
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... qRT-PCR was performed with SYBR green fluorescent dye (Takara, Japan) using a Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP was removed from pEGFP-C1 PLCdelta-PH and replaced with mCherry from pmCherry-C1 (TaKaRa). To create pmCherry-C1 RBDrhotekin ...
-
bioRxiv - Neuroscience 2021Quote: ... The pIRES2-mCherry vector was synthesized by replacing the AcGFP part of pIRES2-AcGFP1 (Takara Bio) with the mCherry sequence ...
-
bioRxiv - Biophysics 2020Quote: ... control cells were infected with lentivirus encoding cytosolic mCherry in a pLVX-Puro vector backbone (Clontech) (Wu et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Cell Biology 2022Quote: All expression plasmids are based on the lentiviral vector pLVX-EF1α-mCherry-N1 (Takara, Cat# 631986). Codon-optimized variants of GPR133 were previously published and described (Frenster et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected calvaria from 9SL or 11SL fish were labeled with antibodies against mCherry (Takara, 1/100), GFP (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Eps8-ΔCAP and IRSp53-mCherry were PCR amplified using PrimeSTAR GXL DNA Polymerase (Takara Bio) and the amplicons were extracted from a 1% agarose gel (Monarch Gel Extraction Kit ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry-H2B HeLa cell lines were cultured in DMEM (PAM Biotech) supplemented with 10% FBS (Clontech), 2 mM L-glutamine (PAN Biotech) ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA fragments corresponding to MV-C or CH coding sequences were amplified using pTM3-MVSchw or pmCherry (Clontech, Palo Alto, USA) as a template ...
-
bioRxiv - Neuroscience 2021Quote: ... a DNA fragment of the TkR86C coding region was amplified from cDNA from the Canton-S wild type strain by PCR (PrimeSTAR GXL, TaKaRa Clontech) with primers that had NotI and XbaI sites at 5’ and 3’ ends ...
-
bioRxiv - Biochemistry 2022Quote: ... The barcodes were introduced immediately after the Tae1 coding sequence via Gibson assembly cloning (In-Fusion HD Cloning Kit – Takara Bio). Our Next-Generation sequencing strategy comprised two stages ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
Lateral organ diversification in plants mediated by the ALOG protein family of transcription factorsbioRxiv - Plant Biology 2019Quote: ... A PCR-amplified eGFP coding sequence was inserted in frame with the 5’ end of the MpTAW1 coding sequence by the In-Fusion cloning reaction (TaKaRa, Japan) to generate the proMpTAW1:eGFP-MpTAW1 plasmid ...
-
bioRxiv - Zoology 2020Quote: ... the longer fragment containing the complete coding sequence of MYL2 was amplified from the longissimus dorsi muscle tissue with special paired-primers and Taq enzyme (Takara, Japan), and then the complete coding sequence of the target gene was amplified with special primers with restriction enzyme cutting sites and protecting bases ...
-
Combinations of maternal-specific repressive epigenetic marks in the endosperm control seed dormancybioRxiv - Molecular Biology 2020Quote: ... and the REF6 coding sequence was inserted into the AatII and Eco32I sites using the In-Fusion® HD Cloning Kit (TaKaRa).
-
bioRxiv - Immunology 2020Quote: ... the coding sequences of MRTFA and MRTFB were PCR amplified and subcloned into the pRetroX-Tight-Hygro vector (Takara Bio, 631034). Doxycycline inducible expression was achieved by pLVX-TetON-Advanced (Takara Bio ...