Labshake search
Citations for Takara Bio :
151 - 200 of 812 citations for IL 5 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cancer Biology 2019Quote: Full-length EML4 cDNA was isolated by PCR from human cDNA (Clontech) and subcloned into a version of pcDNA3 or pcDNA3.1-hygro (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... Human universal reference total RNA (Catalog No. 636538, Clontech, Mountain View, CA) was used as a template to synthesize cDNA by reverse transcription ...
-
bioRxiv - Cell Biology 2021Quote: For expression analysis human multiple tissue cDNA panel (MTC™ Clontech, 636742) and human normal brain tissue qPCR array (OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Naïve human PSCs were cultured in the PXGL medium: Ndiff227 (Takara Bio) medium supplemented with PD0325901 (Sigma,1 μM) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3 ...
-
bioRxiv - Genomics 2019Quote: ... Wild-type sequences were generated by PCR using human genomic DNA (Clontech) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech) as described before 30,31 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... pooled total RNA of human kidney and liver were purchased from Clontech. Total RNA (2 µg ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10 ng cDNA of various tissues (Takara Human MTC panel I & II) were used for each reaction and amplified by KOD Xtreme Hot Start DNA polymerase kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from human tissues was purchased from Clontech (catalog number 636643). Most of these samples represent pooled RNA from multiple individuals (between 2 and 63 individuals) ...
-
bioRxiv - Neuroscience 2022Quote: ... were purchased from Addgene and Genscript or amplified from human adult and fetal brain RNA (Takara) (see Table S10)(Alford et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... ERManI-YFP was constructed with human ERManI cloned into peYFP-N1 (Clontech) using Hind III and Xma I yielding ERManI fused on its C-terminus to YFP through a 6 amino acid flexible linker (SGGGGS) ...
-
bioRxiv - Cell Biology 2023Quote: Human CD34+ HSPCs were cultured overnight on RetroNectin-coated (Takara Bio USA) plates in StemSpan SFEM II medium supplemented with SCF 100 ng/mL ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from human liver and fetal brain was purchased from Clontech Laboratories ...
-
bioRxiv - Developmental Biology 2024Quote: Human naïve cells were cultured in PXGL medium30: N2B27 medium (Takara, Y40002), supplemented with 1uM PD0325901 (Cambridge Bioscience ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Genomics 2019Quote: We used commercially available total RNA from human adipose tissue (Clontech, lot 1604416A) and blood (peripheral leukocytes ...
-
bioRxiv - Biochemistry 2020Quote: ... ADAR1 and PCBP2 cDNA were cloned from human thymus plasmid cDNA library (Clontech) using standard PCR techniques and then subcloned into indicated vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
bioRxiv - Microbiology 2021Quote: The human kidney epithelial cell line Lenti-X 293T was purchased from Takara. The human liver cell line Huh7.5.1 was provided by Dr ...
-
bioRxiv - Immunology 2020Quote: The human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) were maintained in Dulbecco’s Modified Eagles medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog # ...
-
bioRxiv - Cell Biology 2020Quote: ... S5C-E was generated by fusing human Rac1 cDNA into EGFP-C1 (Clontech) and kindly provided by Dr ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...
-
bioRxiv - Molecular Biology 2021Quote: ... was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog # ...
-
bioRxiv - Cancer Biology 2019Quote: Human NIC4 was sub-cloned into pEGFP-N3 (BD Clontech, Mountain View, CA) between EcoRI and BamHI restriction sites to obtain NIC4-GFP using the following primers:
-
bioRxiv - Cell Biology 2019Quote: ... The sequences encoding human Rap1a(Q63E) and Rap1GAP1 were cloned into p3xFlag7.1(-) (Clontech). Transient transfection was performed using TransIT-LT1 Reagent (Mirus ...
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Immunology 2021Quote: 293T Lenti-X human embryonic kidney cell line (Clontech, Mountain View, CA, USA) was used for LV or IDLV production by transient transfection as previously described22,58 ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA pools from human brain (cat. no. 636530, Takara Bio USA, Inc), small intestine (cat ...