Labshake search
Citations for Takara Bio :
401 - 450 of 812 citations for IL 5 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan).
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan).
-
bioRxiv - Biochemistry 2024Quote: ... The sequence of human histone H2A(K15C-129) was cloned into the pCold-Trigger factor (TF) vector (Takara Bio) with a SUMO coding sequence inserted to generate His6–TF–SUMO–H2A(K15C-129 ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’RACE reaction was performed according to the kit manufacturer’s instructions (Clontech / Ozyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... at the C-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The guide RNA was designed to target an immediate downstream of the stop codon of the human GATA3 gene and generated using the Guide-it sgRNA In Vitro Transcription System (Clontech). The target sequences of gRNAs are shown in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA fragment of human METTL18 with a C-terminal HA sequence was cloned into AgeI and EcoRI sites of the pQCXIP vector (Clontech). To generate hMETTL18-Asp193Lys-Gly195Arg-Gly197Arg-HA ...
-
bioRxiv - Immunology 2020Quote: ... Transient retroviral supernatants were produced as previously described.44 Activated NK cells were purified and transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Biochemistry 2019Quote: ... 5’UTRs of MAGED2 TV2 and TV3 were amplified by RT-PCR from RNA isolated from human testes tissue purchased from Takara Bio (Mountain View ...
-
bioRxiv - Plant Biology 2020Quote: ... Plasmids for the PARN activity assay were constructed by inserting the coding sequence of RRD1 or human PARN (hPARN) into the pHAT vector (Clontech). The hPARN sequence was derived from the GNP Human cDNA clone IRAK071M01 (RIKEN BioResource Research Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Neuroscience 2020Quote: We transiently co-transfected cDNA constructs of GluN1 and GluN2A into mammalian human embryonic kidney 293 (HEK293) with a separate pEGFP-Cl vector (Clontech) at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP ...
-
bioRxiv - Cell Biology 2022Quote: pLVX-Puro GFP-TMEM11 was generated by PCR amplifying TMEM11 from human cDNA and cloning into the XhoI/BamHI sites of pAcGFP1-C1 (Takara), followed by subsequent cloning of the GFP-TMEM11 cassette into the Xho/BamHI sites of pLVX-Puro (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Neuroscience 2022Quote: The Yeast-Two-Hybrid screening for Jacob interaction partners was performed using a pretransformed human brain cDNA Library in pACT2 (Matchmaker-GAL4 Two-Hybrid II; Clontech) as described previously (Helmuth et al. ...
-
bioRxiv - Microbiology 2019Quote: Total RNA of the human multiple myeloma cell line KMM-1 was extracted with RNAiso Plus (Takara Bio, Shiga, Japan). A 24-nt RNA ...
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...
-
bioRxiv - Cell Biology 2019Quote: ... The coding sequences of these small GTPase proteins were amplified with polymerase chain reaction (PCR) using KOD-Plus-Neo DNA polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as template cDNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human ZNRF2 was obtained from the Orfeome clone collection (ID 47920) and transferred by Gateway cloning into pGBT9-GW (Clontech). GAD-E2 and GBD-E3 constructs were combined by transformation into PJ69-4α and PJ69-4a ...
-
bioRxiv - Cell Biology 2020Quote: ... of human ACLY was PCR amplified from a HeLa cDNA pool and inserted into the EcoRI-digested pLVX-puro vector (Takara) using the In-Fusion cloning system (Takara) ...
-
bioRxiv - Microbiology 2021Quote: For human ectopic expression plasmids: Full length cDNA for each gene was amplified from a HeLa cDNA library (Takara Bio) and inserted into a pCDNA expression plasmid modified with either a C-terminal HA or N-terminal V5 tag under the human cytomegalovirus (CMV ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Neuroscience 2023Quote: The high-quality human total brain RNA that was used for 3’ RACE was purchased from Clontech (Mountain View, CA). SCA12 KI-10 and KI-80 mouse models were generated using the CRISPR/Cas9 approach by replacing the mouse PPP2R2B exon 2 with the human PPP2R2B exon 7 containing either 10 or 80 CAG triplets (Li and Margolis ...
-
bioRxiv - Microbiology 2023Quote: A yeast screen for human cellular interacting proteins of pUL136 was performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech) and the Mate and Plate Universal Human Library (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by amplifying the coding sequence of human EL from cDNA (LIPG; MGC MHS6278-202806078) and inserting it into the vector pCDNA6 using InFusion cloning (Clontech). An EL containing a T111I mutation (pKS17 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-DsRed-Monomer-N1–hVMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pLVX-DsRed-Monomer-N1 (CLONTECH cat. 632152). pLenti–VMP1–GFP was obtained by cloning the VMP1 sequence (NCBI reference sequence ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragments encoding human zyxin were amplified from the cDNA of U2OS cells and then inserted into the pmCherry-N1 vector (Clontech) for the expression of zyxin-RFP.
-
bioRxiv - Cell Biology 2023Quote: ... The PISD-FLAG plasmid was generated by amplifying human PISD from cDNA and cloning it into the BglII and SalI sites of the pmCherry-N1 vector (Clontech). The C-terminal mCherry tag was subsequently replaced with 3xFLAG tag using the AgeI and NotI restriction sites ...