Labshake search
Citations for Takara Bio :
501 - 550 of 719 citations for IL 10 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were grown in HEK293T medium except 10% tetracycline-free FBS (Takara Bio) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA (1:10 diluted) was mixed with target-specific primers and SYBR Green Supermix (Takara). Data analysis was done using Viia7 sequence detection interface (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... beads were resuspended with 27 µl ddH2O and 1 µl 10× Ex-Taq buffer (TaKaRa). 1 µl proteinase K (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a final extension at 72 °C for 10 min using Advantage2 polymerase mix (Clontech); specific primers were designed for cloning the putative spexin ligands and receptors (Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... U2OS cells were grown in DMEM supplemented with 10% tetracycline-free foetal bovine serum (Clontech), 100U/ml penicillin and 100µg/ml streptomycin ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ml of virus containing media were concentrated with Lenti-X concentrator (Takara Bio, 631231) to a titer sufficient to decrease pStat1 levels by 25% (Mean pStat1+ CD11b+ cells ...
-
bioRxiv - Genomics 2019Quote: ... We mixed 2 µg of total RNA with 1 µl 10 mM dNTPs (Clontech #639125) and 1 µl of 50 µM SMART_dT18VN primer (for a complete list of primer sequences ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology) on a CFX Connect TM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... T-REx™-293 cells were purchased from Thermo Fisher Scientific and cultured in MEM GlutaMAX™ supplemented with 10% Tet system approved FBS (Clontech) and 5 µg/ml blasticidin ...
-
bioRxiv - Genetics 2021Quote: ... Viral supernatant was further concentrated 10-fold using the lenti-X™ Concentrator (Takara Bio) following the manufacturer’s instructions and subsequently stored at −80°C.
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1%BSA and 10% FBS.Cells were incubated with anti-c-Myc antibody (Clontech Laboratories, USA) at a 1:10 dilution for 16 hr at 4°C ...
-
bioRxiv - Genomics 2021Quote: Hap1 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% FCS (Clontech), 1% Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 6.8 μl of ddH2O and 10 μl of Power SYBR Green qPCR Master Mix (TaKaRa). Three technical replicates ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 μl of TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (TaKaRa Bio), 0.4 μl of forward and reverse primers (10 μM) ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA (10 ng) was extracted for library preparation using a SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction mixture contained 10 μL of SYBR® Primer EX Taq II (Takara, Japan, RR420A), 0.4 μL ROX Reference Dye (50× ...
-
bioRxiv - Genetics 2022Quote: ... The 20 µL PCR reaction volume included 10 µL Premix Ex Taq enzyme (Takara Biomedical Technology), 0.2 µL BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... media was collected and concentrated 1:10 in 1xPBS using Lenti-X concentrator (Takara Bio, #631231), aliquoted ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions contained 10 μl SapphireAmp Fast PCR Master Mix (Takara Bio USA, Mountain View, CA), 0.3 μl of each primer (10 μM stocks) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DIE cells were cultured in IMDM media supplemented with 10% Tet system approved FBS (Clontech), 5μg/ml Puromycin and 6μg/ml Blasticidin ...
-
bioRxiv - Genomics 2021Quote: ... Two DNA polymerases were evaluated (barcode 10 used high-fidelity LA (for “long amplicon”) Taq (Takara); barcode 11 Taq (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry-H2B HeLa cell lines were cultured in DMEM (PAM Biotech) supplemented with 10% FBS (Clontech), 2 mM L-glutamine (PAN Biotech) ...
-
bioRxiv - Genetics 2022Quote: ... in a 10 µL reaction volume with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2023Quote: ... (Cat.No. 632180) were cultured in DMEM supplemented with 10% Tet System Approved FBS (Takara, Cat.No. 631106). All cell lines were cultivated at 37°C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Physiology 2024Quote: ... 10 μM Reverse primer and TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, #RR820W). Real-Time PCR was set up in a 384-well plate and run in a CFX384 Real-Time PCR System (BioRad ...
-
bioRxiv - Genetics 2019Quote: RNA oligo (10 pmol) were incubated with 2.5 U MazF (mRNA intereferase-MazF, Takara, code No. 2415A) in the 20 ul reaction mixture of MazF buffer (40 mM sodium phosphate (pH 7.5 ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... containing 10 μl of TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa, #RP820A; Dalian, China) and 0.4 μM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... Rearranged VDJ IGM and IGG amplicons were generated using a universal forward primer (Takara Bio;10 μM), and either an IgM-CH3 (5’-CAGATCCCTGTGAGTCACAGTACAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Tet System Approved FBS (Clontech), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated 30 min at RT and loaded onto a 10 μL aliquot of Talon (Takara) resin ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was then reverse transcribed in 10 µL reactions using PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...