Labshake search
Citations for Takara Bio :
451 - 500 of 719 citations for IL 10 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviral particles were concentrated 10-fold using Lenti-X Concentrator (Takara Biosystems 631231).
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 10% (v/v) Tet-system approved fetal bovine serum (Takara Bio) and 100 µg/ml of G418 (Nacalai Tesque) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction was terminated by adding 10× loading buffer (Takara, Otsu, Shinga, Japan) and analyzed by electrophoresis on a 1% agarose gel and stained with ethidium bromide.
-
bioRxiv - Developmental Biology 2019Quote: ... the 10 mL of viral supernatant were concentrated with LentiX Concentrator (Takara, 631231) due to the lower viral titer (Datlinger et al ...
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... Twenty μL reaction volumes containing 10 μL SYBR premix ExTaq (TAKARA, Dalian, China), 0.6 μL of each of the forward and reverse primers ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transferred to fresh medium containing 10% Tet System Approved FBS (Clontech) and 1 µg/mL puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 ng of template DNA was combined with PrimeStarMax DNA Polymerase (Takara #R045Q) and 300nM primers and amplified using a BioRad T100 Thermal Cycler ([98°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 ng of template DNA was combined with PrimeStarMax DNA Polymerase (Takara #R045Q) and 300nM primers and amplified using a BioRad T100 Thermal Cycler ([98°C ...
-
bioRxiv - Immunology 2023Quote: ... 1 μg/ml anti-hCD28 and 10 μg/ml RetroNectin (Takara, Cat# T100A). PBMCs were loaded in these wells in human T cell media (X-VIVO media ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant stirred with 10 mL of TALON metal affinity resin (Takara Bio US) equilibrated in Buffer A (480 mM NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and concentrated 10-fold using Lenti-X concentrator (Takara Bio, Mountain View, CA, USA). CasRx-GFP lentiviral particles were produced by co-transfecting plasmids encoding CasRx-GFP (PXR001 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and concentrated 10-fold using Lenti-X concentrator (Takara Bio, Mountain View, CA, USA). To obtain cells with stable CasRx-GFP expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 10-day-old seedlings with RNAiso Plus (Takara, Japan) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg PolyA RNA was isolated using Magnosphere® Ultrapure mRNA Purification Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl premix WST-1 cell proliferation reagent (Takara Bio Inc, Clontech Laboratories, Inc.) was added to each well ...
-
bioRxiv - Biochemistry 2022Quote: ... respectively) were carried out using a growth medium containing 10% Tet-Approved FBS (Clontech) in place of standard growth serum ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μl reaction mixture contained 10 μl 2×TB green Premix DimerEraser (Takara), 1 μl of each primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl premix WST-1 cell proliferation reagent (Takara Bio Inc, Clontech Laboratories, Inc.) was added to each well ...
-
bioRxiv - Immunology 2022Quote: ... Lenti-X 293T packaging cells were obtained from Takara-Clontech and were cultured in DMEM supplemented with 10% tetracycline-free FBS (Takara-Clontech), 200 mM L-glutamine ...
-
bioRxiv - Immunology 2022Quote: ... Lenti-X 293T packaging cells were obtained from Takara-Clontech and were cultured in DMEM supplemented with 10% tetracycline-free FBS (Takara-Clontech), 200 mM L-glutamine ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; Takara, Dalian, China), 0.8 μL of each primer (Table 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa-KRAS(G12V) cells were maintained in 10% tetracycline-free FBS (Takara Bio, 631101) and KRAS(G12V ...
-
bioRxiv - Genetics 2022Quote: ... Viral supernatant was further concentrated 10-fold using the lenti-XTM Concentrator (Takara Bio) following the manufacturer’s instructions and subsequently stored at −80 °C.
-
bioRxiv - Microbiology 2022Quote: ... 10 μL reaction volume of TB Green® Premix Ex TaqTM II (TaKara, Japan), which included 40ng fecal DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (Takara, Beijing, China), 0.8 μL of 10 μM bidirectional primers (Table 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Greenberg) were cultured in DMEM supplemented with 10% tetracycline-free fetal bovine serum (Takara) and antibiotics ...
-
bioRxiv - Cell Biology 2023Quote: ... concentrated down 10 or 30 times using the Lenti-X Concentrator (631232; Takara Bio). Supernatants were kept at -80°C prior to being directly applied to target cells which were then spun at 700 xg for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were grown in HEK293T medium except 10% tetracycline-free FBS (Takara Bio) was used ...
-
bioRxiv - Microbiology 2023Quote: ... was grown in RPMI 1640 medium supplemented with 10% Tet System Approved FBS (TaKaRa), penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all supplemented with 10% tetracycline-free Fetal Bovine Serum (FBS) (Clontech and DSS Takara). Cells were trypsinized and sub-cultured in desired culture vessels when at 90% confluency ...