Labshake search
Citations for Takara Bio :
151 - 200 of 5326 citations for Human NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Kir2.1 pathological mutants (C154Y, R312H) were generated by polymerase chain reaction (PCR) with synthetic primers using the CloneAmp HiFi PCR Premix (Takara). Primer sets used for site-directed mutagenesis were the forward sequence ‘5-GTGACTGATGAGTACCCAATTGCAGTGTTTATGGTG –3’ ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Plant Biology 2020Quote: The polymerase chain reaction (PCR) was performed on genomic DNA using Emerald Amp MAX PCR Master Mix (Takara Bio, CA, USA) using the primers given in Table S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis was performed using TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio) on a Thermal Cycler Dice Real Time System TP800 (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... Polymerase chain reaction (PCR) was performed using the primer set Fish-F1 and Fish-R229 and Tks Gflex DNA polymerase (Takara, Japan). The PCR product was directly sequenced at Macrogen Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... The quantitative real-time-polymerase chain reaction (qRT-PCR) was conducted with SYBR Premix Ex Taq™ II (Takara, Dalian, China), and performed on on a QuantStudio™ 7 Flex Real□Time PCR System ...
-
bioRxiv - Genomics 2024Quote: ... The polymerase chain reaction (PCR) was performed on genomic DNA to amplify 16s rRNA using Emerald Amp MAX PCR Master Mix (Takara Bio) using the primers presented in Table S1.
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Biophysics 2019Quote: ... Site-directed mutagenesis was achieved by polymerase chain reaction (PCR) of the full-length plasmid containing the Nav gene using PrimeSTAR® MAX DNA Polymerase (Takara Bio.). All clones were confirmed by DNA sequencing.
-
bioRxiv - Microbiology 2019Quote: ... The SLC7A1 cDNA from each sample was amplified by polymerase chain reaction (PCR) using PrimeSTAR GXL DNA polymerase (Takara Bio, Otsu, Japan). The amplification profile included 98 °C for 2 min followed by 30 cycles of 98 °C for 15 s ...
-
bioRxiv - Biochemistry 2020Quote: ... Polymerase chain reaction (PCR) was used to amplify the intron 1 of HIF3A using EpiTaqTM HS (for bisulfite-treated DNA; Takara, Shiga, Japan). Levels of DNA methylation were quantified using pyrosequencing with the PyroMark Q24 Advanced kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... and NOS3 were detected using quantitative real-time polymerase chain reaction (qRT-PCR) with TB Green™ Premix Ex Taq™ II (Takara) in the LightCycler96 system (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... The quantitative real-time polymerase chain reaction was performed using the ABI 7300 sequencer and SYBR Premix Ex Taq-TM (RR420, Takara, Kyoto, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and spectinomycin-resistant gene with lacI–spac promoter unit were amplified through polymerase chain reaction (PCR) using PrimeSTAR DNA polymerase (TaKaRa, Shiga, Japan), along with appropriate primer sets (namely F1/R2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed in triplicates using TB Premix Ex Taq II (Takara Bio, #RR390A, Japan) in a QuantStudio 6 Flex Real-Time PCR System using QuantStudio Real-Time PCR Software (both Applied Biosystems ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Biochemistry 2024Quote: ... and XcSGL (KEGG locus tag, XCC2207) were amplified by PCR chain reaction using KOD plus (TOYOBO, Osaka, Japan) or PrimeSTAR Max (Takara Bio, Shiga, Japan) for the DNA polymerase and the primer pairs ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).