Labshake search
Citations for Takara Bio :
451 - 500 of 5326 citations for Human NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Cell Biology 2020Quote: The commercially available Cellartis Human iPS Cell Line 12 (Takara Bio Inc., Kusatsu, Japan) was used as the human iPS Cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA from the human brain (#636530) and testis (#636533) was purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... was generated by PCR amplification of human S1R gene (www.ncbi.nlm.nih.gov/nuccore/NM_005866.3) and cloning into pEGFP-N2 vector (Clontech) using HindIII/XbaI cloning sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The HB-EGF cDNA was obtained from the Human Brain Matchmaker cDNA library (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEC1 and BUBR1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B55α was PCR amplified from HUVEC cDNA and cloned into pEGFP-C1 (Clontech) using HindIII and BamHI sites ...
-
bioRxiv - Biophysics 2022Quote: ... and human CaMKIIK42RD135N with a C-terminal AviTag were cloned into pEGFP-N1 (Clontech) vector ...
-
bioRxiv - Biophysics 2022Quote: The coding sequence of human PAC (NP_060722) previously subcloned into pIRES2-EGFP vector (Clontech) using XhoI and EcoRI restriction enzyme sites9 was used for whole-cell patch clamp recording ...
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: Human DHRS7 was expressed as a GFP fusion using the pEGFP-N2 vector (Clontech) generated previously [5] ...
-
bioRxiv - Synthetic Biology 2023Quote: Human Embryonic Kidney (HEK) 293 cells (ATCC, CRL-1573) and HEK293T-LentiX (Takara Biosciences) were cultured in standard culture conditions (37ºC and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human CXCR4 was cloned into the pAcGFPm-N1 plasmid (Clontech Laboratories, Palo Alto, CA), as described (20).
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney cells (Lenti-X 293T Cell line from Takara. Cat no. 632180) were grown in DMEM/F12 media (GIBCO ...
-
bioRxiv - Molecular Biology 2024Quote: The human embryonic kidney (HEK) 293T cell line was purchased from Takara (Cat# 632180) and cultured in a humidified 95% air / 5% CO2 incubator at 37°C in a standard Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2022Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat# 635683) column was equilibrated with ten column volumes of Equilibration Buffer (HisTALON Buffer Set ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 5 μL of Premix Ex Taq (Takara, Dalian, China), and 1.5 μL of a mixture of probe (5’-TGCAC GTTGT GACAG TCGT-3’ ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 2.5 mM dNTPs (Takara Bio Inc.), 1 μL of 20 μM TruSeqUniv (Supplementary Table S7) ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 10× ExTaq buffer (Takara Bio Inc.), 5 μL of 2.5 mM dNTPs (Takara Bio Inc.) ...
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat # 635683) column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 units of recombinant DNase I (TaKaRa, Kyoto, Japan), 200 units of RevertAid™ reverse transcriptase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 5 µL of 2.5 mM dNTPs (Takara #4025), with the following thermal cycle condition ...
-
bioRxiv - Genetics 2023Quote: ... mixed with 5 mL Lenti-X Concentrator (Takara, 631232) and rocked at 4 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Duke University Medical Center) and HeLa Tet-Off (HTO; human, female, cervix; Clontech, RRID: CVCL_V352) cells were cultured in high-glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... The WT hPNPO cDNA was amplified from the human brain cDNA library (TaKaRa, Cat #637242) [24] ...
-
bioRxiv - Developmental Biology 2021Quote: ... cryosectioned brains were stained to detect expression of human cytoplasmic marker STEM121 (TaKaRa, cat. Y40410) and human-specific GFAP marker STEM123 (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney 293T cells (‘293T’) and Lenti-X 293T cells were purchased from Clontech/Takara Bio (Mountain View ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Cell Biology 2020Quote: ... CHO-K1 cells were transfected with ACP-human IR plasmid using Xfect transfection reagent (Takara). 1 day after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... Shortly, hiPSC lines (C1, C2, C3) and the commercial human iPSC-line Chipsc4 (Takara, Sweden) were cultured and differentiated into cortical NSCs as described elsewhere (23) ...
-
bioRxiv - Cell Biology 2022Quote: Full length wild type human RORβ (NM_006914.3) was subcloned into the pLPCX retroviral vector (Clontech) using XhoI and NotI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2019Quote: PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1; Takara Bio Inc. ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA encoding human full-length MuSK was cloned into pIRES2-EGFP plasmid vector (Clontech). AChR and MuSK vectors were kindly provided by Drs ...
-
bioRxiv - Neuroscience 2022Quote: 50 µg of human cerebral cortex lysate (Protein Medley, Takara, Kusatsu, Japan, Cat. No. 635323) were diluted and prepared according to manufacturer’s instructions (protocol PT1602-1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The bait stain was combined with a Mate & Plate™ Human Heart library (Takara Bio) for 24 hours after which cells were plated on selective synthetic defined (SD ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...