Labshake search
Citations for Takara Bio :
101 - 150 of 6052 citations for Human Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and as a prey to the activation domain of the GAL4 transcription factor (GAL4-AD) in plasmid pACT2 (Clontech). To monitor the induction of a HIS3 reporter gene by complexes of bait and prey fusion proteins ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified using the corresponding primers (Supplementary Table S3) and fused with the DNA-binding or activation domain of GAL4 in the corresponding pGBT9 and pGAD424 vectors (Clontech). Details of assembling the constructs for expressing proteins in transgenic flies are available upon request.
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Microbiology 2021Quote: ... yeast containing the Gal4 activation domain-based prey and the Gal4 DNA-binding domain-based bait vectors were grown overnight in SD-Leu-Trp broth (Clontech). The OD600 value was recorded ...
-
bioRxiv - Cell Biology 2020Quote: ... Point mutants of the microtubule-binding domain were created using site-directed mutagenesis using PrimeSTAR Max DNA polymerase (Takara Bio).
-
bioRxiv - Plant Biology 2022Quote: ... fragments were recombined into GW versions of the GAL4 DNA-binding domain vector pGBT-9 and the activation domain vector pGAD424 (Clontech). Oligonucleotides used for cloning are listed in Supplementary Table S3.
-
bioRxiv - Plant Biology 2022Quote: ... The CWLP coding region without signal peptide (SP) was cloned in frame downstream of the GAL4 DNA-binding domain in the bait vector pGBKT7 (Clontech) and introduced into the yeast strain AH109 (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... where the entire ORF of the corresponding gene was inserted in frame into the pGADT7 (GAL4 activation domain) or pGBKT7 (GAL4 binding domain) plasmid (Clontech).
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cell Biology 2023Quote: candidate factors were prepared by subcloning the ORF template clones by PCR amplification with Prime STAR GXL DNA polymerase (Takara) and ligation by In-Fusion cloning enzyme (Clontech).
-
bioRxiv - Biochemistry 2019Quote: ... A native poly-histidine region within the Spir-KIND domain is sufficient for binding of these constructs to TALON® resin (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human total RNA from different normal tissues from Clontech (Human Total RNA Master Panel II,Cat# ...
-
bioRxiv - Cell Biology 2019Quote: ... and human BaxS184V was cloned in pEGFP-C1 (Clontech). Bax/Bak DKO MEFs were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Human colon cDNA purchased from Clontech (Palo Alto, CA) was used as the template ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human stomach tissue RNAs were purchased from TaKaRa Bio (Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...