Labshake search
Citations for Takara Bio :
1 - 50 of 6052 citations for Human Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Genomics 2019Quote: ... enhancer assay vector using In-Fusion HD cloning kit (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl Cloning Enhancer (Takara) was added to 20 µl of the PCR product and incubated for 15 min at 37 °C on a thermocycler ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... Reactions were treated with Cloning Enhancer (Clontech Laboratories Inc) to remove circular template ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Candidate enhancers were PCR amplified (Takara PrimeSTAR GXL premix, R051A) from mouse genomic DNA using primers listed below ...
-
bioRxiv - Developmental Biology 2021Quote: Enhancer plasmids were co-electroporated with pCMV-DsRed-Express-N1 (Clontech) which labels all electroporated cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... Predicted enhancer elements were PCR-amplified from mouse genomic DNA (Clontech) and cloned into the respective LacZ expression vector (Osterwalder et al ...
-
A gene desert required for regulatory control of pleiotropic Shox2 expression and embryonic survivalbioRxiv - Developmental Biology 2023Quote: ... Predicted enhancer elements were PCR-amplified from mouse genomic DNA (Clontech) and cloned into a Hsp68-LacZ expression vector for random integration114 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2024Quote: ... The sequence of human histone H2A(K15C-129) was cloned into the pCold-Trigger factor (TF) vector (Takara Bio) with a SUMO coding sequence inserted to generate His6–TF–SUMO–H2A(K15C-129 ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATAC-identified enhancers were inserted into the ZED vector by In-Fusion cloning (Cat. #638910, In-Fusion HD Cloning Plus Kits, Takara Bio) using BspEI and BmgBI cutting sites for linearisation ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Developmental Biology 2020Quote: ... Hmx1 putative enhancer elements were amplified by PCR from total genomic DNA using the LA Taq PCR kit v2.1 (TaKaRa, Mountain View, CA) and the following primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the ATOH1 enhancer sequence was cloned using in-fusion HD cloning (Clontech). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Developmental Biology 2024Quote: ... Col2a1a enhancer was amplified from the plasmid -1.7kbcol2a1a:EGFP-CAAX (24) using CloneAmp HiFi premix (Takara #639298) with the primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Genomics 2021Quote: ... primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Cell Biology 2023Quote: Diploid human retinal pigment epithelium hTERT-RPE 1 cells (Clontech) were grown in DMEM/F-12 (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Developmental Biology 2022Quote: Candidate enhancer sequences identified from the integrated analysis from scRNA-seq and scATAC-seq were PCR amplified (TAKARA, PrimeSTAR GXL) from mouse genomic DNA and PCR products cloned into pGL4.23 (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-human GFAP (mouse IgG1, 1:2000, Takara Bio, Shiga, Japan), anti-CNPase (mouse IgG1 ...
-
bioRxiv - Plant Biology 2020Quote: ... plant intron Syn7 [34] regulated by a double-enhancer Cauliflower mosaic virus 35S RNA promoter (P35S2) and a nos terminator in the T-DNA binary vector pBI121 (Clontech, Switzerland). Syn7 was amplified with the primers 5′- GAGCTGAAAGggtaagattatcgatatttaaattatttatttcttcttttc-3′ and 5′-TGAAGTCGATGCctgcatgatatcataaaaccatgga-3′ specifying the splicing junctions and then inserted into the YFP coding region by overlapping PCR ...
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...