Labshake search
Citations for Takara Bio :
301 - 350 of 2962 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... The virus-containing media was concentrated with LentiX Concentrator (Takara) and resuspended in Neurobasal (Gibco).
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Bioengineering 2023Quote: ... All virus was titrated with Lenti-X GoStix Plus (Takara) before being aliquoted and stored in −80 °C.
-
bioRxiv - Bioengineering 2023Quote: ... Virus was titered using Lenti-X GoStix Plus (Takara Bio). Lentivirus encoding GFP was purchased by VectorBuilder (Chicago ...
-
bioRxiv - Molecular Biology 2023Quote: ... Virus was concentrated 100 times by Lenti-X Concentrator (Takara) after filtering through a 0.45 syringe filter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The filtered virus was concentrated using the LentiX concentrator (Takara) at 1500 x g for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the NucleoSpin RNA Virus was from Takara (cat. 740956)
-
bioRxiv - Neuroscience 2024Quote: ... Collected crude virus was concentrated with Lenti-X (Takara Bio) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus was concentrated with polyethylene glycol (Lenti-X, Takara, #631232). Lentivirus was produced in airway epithelial cell expansion medium supplemented with Y27632 and retinoic acid as described95 ...
-
bioRxiv - Microbiology 2019Quote: The dual-luciferase assay using an NF-□B–dependent firefly luciferase (pNF-□B-Luc; Clontech) and a Renilla luciferase driven by the thymidine kinase promoter (pRLTK ...
-
bioRxiv - Plant Biology 2019Quote: ... Then 1 µg of RNA sample was used for reverse transcription (Takara). The resultant cDNA of corresponding genes and ACTIN7 was analysed using the SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... Virus was then concentrated from the media 1:10 in PBS using Lenti-X concentrator (Takara Bio, Cat. No. 631231), aliquoted and stored at −80°C for future use.
-
bioRxiv - Systems Biology 2023Quote: ... were delivered by spinfection into 100k cells using 1 mL of unconcentrated lentivirus or virus that was concentrated 5x with LentiX Concentrator (Takara). Blasticidin was added at day 3 or 5 to select for dCas9 delivery ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Cell Biology 2023Quote: Diploid human retinal pigment epithelium hTERT-RPE 1 cells (Clontech) were grown in DMEM/F-12 (Gibco ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Molecular Biology 2020Quote: ... virus supernatant was concentrated with Lenti-X™ Concentrator (Takara, #631231) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... Virus titer was determined using Lenti-XTM GoStixTM Plus (Takara Bio), and Huh7 cells were infected at a MOI of 5 ...
-
bioRxiv - Genetics 2022Quote: ... Virus titer was estimated using Lenti-X GoStix Plus (Takara, 631281) after 100x dilution ...
-
bioRxiv - Physiology 2024Quote: ... Virus concentration was determined using Lenti-X GoStix Plus (Takara Bio) after one freeze-thaw cycle to be consistent with experimental conditions.
-
bioRxiv - Immunology 2023Quote: ... The virus titer was determined using Lenti-XTM GoStix Plus (Clontech).
-
bioRxiv - Neuroscience 2023Quote: Rabies genomes were exacted by NucleoSpin® RNA Virus (740956.50, Takara), RT-PCR was performed with AccuScript PfuUltra II RT-PCR Kit (600184 ...
-
bioRxiv - Molecular Biology 2024Quote: ... separated by an encephalomyelitis virus internal ribosome entry site (IRES) (Clontech), were cloned into the MCS of an GreS base vector ...
-
bioRxiv - Cell Biology 2024Quote: ... The virus titer was determined using Lenti-X GoStix Plus (Clontech). To transduce hTCEpi cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... Foamy virus was produced using Lenti-X 293T (Takara Bio, Kusatsu) generated as previously described and frozen at -80°C for long term storage42 ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcribed (Takara), and quantified using SYBR green PCR master mix on a Roche LightCycler 480II ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed (TaKaRa), amplified ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse-transcribed (TaKaRa), amplified ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse transcription (TaKaRa) was performed ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse transcription was performed using the M-MLV reverse system (Takara) to obtain cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was conducted using a reverse transcription kit (TAKARA, Japan) according to the manufacturer’s protocol to synthesize cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-human GFAP (mouse IgG1, 1:2000, Takara Bio, Shiga, Japan), anti-CNPase (mouse IgG1 ...
-
bioRxiv - Cell Biology 2020Quote: ... generates a protein that undergoes spontaneous aggregation that reverses upon the addition of D/D solubilizer (catalogue# 635054; Takara Bio), a cell-permeant rapamycin analog that binds to the FM4 domains (see Fig 3e).
-
bioRxiv - Genomics 2019Quote: ... We concentrated the virus 100-fold with Lenti-X concentrator (Clontech, 631231) following the manufacturer’s recommendations before aliquoting and freezing at -80C.
-
bioRxiv - Immunology 2023Quote: ... Virus supernatant was harvested three days later and coated on retronectin (TaKaRa)-treated plates (incubated overnight at 4°C previously ...
-
bioRxiv - Cancer Biology 2023Quote: ... Virus particles were precipitated with Lenti-X Concentrator (#631232, Takara Bio, Japan), suspended in phosphate buffer saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... we further concentrated virus stocks using Lenti-X™ Concentrator (Takara, 631232) to between 3.5*10^5-1.5*10^6 TU/ml.
-
bioRxiv - Cell Biology 2024Quote: ... Virus was produced by Lenti-X™ 293T cells (Takara Bio USA), transfected with lentiviral expression vector (330 ng) ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Plant Biology 2021Quote: ... and reverse transcribed (TAKARA). Transcription of corresponding genes and ACTIN7 was analysed using SYBR Premix Ex Taq (TAKARA ...
-
bioRxiv - Cell Biology 2022Quote: ... and reverse-transcribed (Takara). BTRC was amplified with the primers of 5’-GGAGAAGACTTTGACCAGCG-3’ and 5’-CTTTGGAATTCGAGTCGAGC-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 ug RNA was reverse transcribed using a PrimeScript RT-PCR kit (Takara Bio) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse transcription was performed with 1 μg RNA using PrimeScript RT reagent Kit (Takara). The cDNA was amplified with gene-specific primers (Supplemental Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg total RNA was reverse-transcribed using PrimeScript RT reagent Kit (RR047A, TaKaRa). Quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of RNA was reverse transcribed using PrimeScriptTM RT reagent Kit (Takara, #RR047A). Real-time quantitative PCR was performed using SYBR Green Mix (Abclonal ...