Labshake search
Citations for Takara Bio :
451 - 500 of 2962 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription was carried out with 1 μg RNA using TB Green Premix Ex Taq™ II (Takara, Japan). Targets of around 110 bp were amplified with primers qtaxB-F/R ...
-
bioRxiv - Genetics 2022Quote: ... 1 µg of total RNA was used for reverse transcription using PrimeScript RT Reagent Kit (Cat#RR037A, TaKaRa, Japan). Quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 mg) was reverse transcribed using the PrimeScript RT Reagent Kit with the gDNA Eraser (TAKARA, Japan). Quantitative PCR reactions were performed using the gene-specific primers of FLC and FT (Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 ug of RNA was reverse-transcribed into cDNAs using the Prime Script RT Reagent Kit (Takara, RR037B) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of total RNA was reverse transcribed using the double primed RNA to cDNA EcoDry premix (Takara Bio). Primers were designed targeting FLuc ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cDNAs were produced using BioRad Reverse Transcription Kit (iScriptTM Reverse Transcription Supermix) or the PrimeScript RT reagent kit (RR037A, TaKaRa). cDNAs from HEK and THP89 cells were quantified by quantitative PCR using Bio Rad’s SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Microbiology 2019Quote: ... 226 or 464 site mutation forward and reverse primers and 20 μM each of JEV-NS3 forward and reverse primers using PrimeSTAR GXL DNA Polymerase (TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Pathology 2020Quote: ... and then 8μL of each was reverse transcribed into cDNA by using the commercial company's reverse transcription kit (TAKARA No. 6110A). The full-length spike gene (3882 nt ...
-
bioRxiv - Neuroscience 2023Quote: ... Isolated RNA was dissolved in 10 μl of DEPC-treated water and reverse-transcribed using a reverse transcription reagent kit (PrimeScript RT Reagent Kit with gDNA Eraser, Takara) and a thermal cycler (Mastercycler ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Genomics 2019Quote: ... RNA was reverse transcribed using Smartscribe RT (Clontech) and ISPCR-OligodT primer ISPCR-TSO (Table S1) ...
-
bioRxiv - Neuroscience 2022Quote: ... The reverse transcription kit was purchased from Takara-Clontech (6210A ...
-
bioRxiv - Microbiology 2020Quote: ... reverse transcription (PrimeScript™ RT reagent Kit, Takara) and to remove genomic DNA (TURBO DNA-free kit ...
-
bioRxiv - Genomics 2021Quote: ... The Prime script reverse transcript kit (Takara, #RR037A) was used to synthesize the cDNA ...
-
bioRxiv - Immunology 2021Quote: ... After reverse transcription (PrimeScript RT reagent kit, Clontech), real-time polymerase chain reaction was performed with the 7900HT Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... RNA was reverse transcribed using Smartscribe RT (Clontech). For each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNAs were synthesized with reverse transcription kit (TaKaRa) with oligo d(T ...
-
bioRxiv - Neuroscience 2023Quote: ... reverse transcribed by PrimeScript RT reagent Kit (Takara) and quantified using SYBR Green Real-Time PCR Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... and reverse transcribed using PrimeScript RT mastermix (Takara). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Immunology 2023Quote: ... and reverse transcribed (PrimeScript RT reagent kit, TaKaRa). Real-time qPCR was performed with the QuantStudio™ 6 Pro Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was reverse transcribed to cDNA by Takara PrimeScript RT reagent kit (RR0036A ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Plant Biology 2020Quote: ... Transferred proteins were first probed with anti-GFP (Takara Bio, 1:5,000 dilution) for 16 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The collected media containing virus was filtered through 0.45μm pore filter and mixed with Lenti-X concentrator (Clontech) as indicated by manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... The vaccinia virus DNA polymerase was used to clone the protospacers into a lentiviral construct (In-fusion, Takara). The lentiviral construct was linearized by Bfua1 digestion (New England Biolabs) ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... The viral supernatants were collected 72 hr after transfection followed by virus concentration using Lenti-X concentrator (TaKaRa). Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Biophysics 2023Quote: ... The virus of each construct was produced in Lenti-X™ 293 T Cell Line (Takara, Cat. #632180) and previously described74 ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was collected from the LentiX-293T cells and concentrated using Lenti-X Concentrator (Takara Bio). pLVX-Tet3G virus and polybrene was added to L6-myoblast cells and cells were positively selected using neomycin to create Tet3G expressing cells ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: Cells were lysed and RNA was reverse transcribed and amplified according to the SMARTer Ultra Low RNA Kit for Illumina Sequencing (version 1, Clontech). Libraries were prepared from cDNA using the NEBNext Ultra DNA library preparation for Illumina sequencing with indexed adaptors (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNAs of 0.5 to 1 μg were used as templates for the reverse transcription using PrimeScriptTM RT Reagent Kit with gDNA Eraser (Takara). Quantitative PCR (qPCR ...
-
bioRxiv - Physiology 2021Quote: ... The RNA (1 ug/sample) was reverse transcribed into cDNA and Q-PCR was performed using a SYBR Green PCR kit (Takara) in a Light Cycler (Eppendorf) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then each RNA sample (1 μg) was reverse transcribed using the Prime Script first-strand cDNA synthesis kit (catalog no. 6110A; TaKaRa). The internal control for qRT-PCR experiments was the 18S rRNA gene of BPH ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription (RT) reactions were performed with 1 μg total RNA using the PrimeScript RT kit with gDNA Eraser (Takara). The resulting cDNA was amplified in triplicate on the 480 Real-Time PCR system (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Reverse transcription (RT) reactions were performed with 1 μg total RNA using the PrimeScript RT kit with gDNA Eraser (Takara). The resulting cDNA was amplified in triplicate on the 480 Real-Time PCR system (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScript™ RT Reagent Kit (Takara, RR047B). Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...