Labshake search
Citations for Takara Bio :
501 - 550 of 2435 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: Lenti-X 293T cells (Takara Bio #632180) were seeded at approximately 7e5 cells/well in a 6-well plate to yield ∼80% confluency the following day ...
-
bioRxiv - Synthetic Biology 2024Quote: Lenti-X 293T cells (Takara Bio #632180) were seeded at approximately 7e5 cells/well in a 6-well plate to yield ∼80% confluency the following day ...
-
bioRxiv - Synthetic Biology 2024Quote: Lenti-X 293T packaging cells (Clontech #11131D) were cultured in medium consisting of Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Synthetic Biology 2024Quote: Lenti-X 293T packaging cells (Clontech #11131D) were cultured in medium consisting of Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Synthetic Biology 2024Quote: Lenti-X 293T packaging cells (Clontech #11131D) were cultured in medium consisting of Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2024Quote: Lenti-X 293T cells (Takara, Cat # 632180) were transfected with each CAR expression plasmid and Mirus Bio™ TransIT™-Lenti Transfection Reagent (Cat # MIR6600) ...
-
bioRxiv - Biochemistry 2024Quote: ... Lenti-X 293T (Cat# 632180, Takara Bio) cells were seeded on 6-well plates (∼400,000 cells/well ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids to Lenti-X HEK293T cells (Takara) to generate lentiviral particles for transduction of the target cells as described in detail previously (Elegheert et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Lenti-X™ 293T Cell Line (Takara) was cultured in 90% DMEM with high glucose (4.5 g/L) ...
-
bioRxiv - Microbiology 2023Quote: iSLK cells and Lenti-X 293T (Takara) were maintained in DMEM (Gibco +glutamine ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected either with GluK3EM or co-tansfected with Wild type/mutant receptors along with GFP expressing plasmid (2 µg/dish) using Xfect reagent (Clontech). Currents were recorded from medium sized cells expressing a moderate level of fluorescence from either the fused EGFP in case of GluK3EM or co-expressed EGFP and having a capacitance of ∼5-6 pF at 48-60 hours post transfection ...
-
bioRxiv - Immunology 2020Quote: ... The entirety of each of the annotated intracellular domains was ordered as a separate gene fragment (Integrated DNA Technologies) and each complete receptor was cloned into pHR lentiviral expression vector (Clontech). Each region of the protein was amplified using PCR and fragments were combined using Gibson assembly.
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells and hippocampal neurons were transfected with plasmids encoding FM4 recombinant receptors for 15 h and then treated with 2 μM DD-Solubilizer (TakaraBio/Clontech) to induce the release of the receptors from the ER into the secretory trafficking ...
-
bioRxiv - Immunology 2023Quote: ... Human lung fibroblast MRC-5 cells were obtained from ATCC® (CCL-171™) and Lenti-X™ 293T cells were obtained from TakaRa (Mountain View CA, USA). All were propagated in complete DMEM (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... subsequently placed in a line in the electrode gap filled with 5 μl the mixture of 120 ng/μl Cas9 protein (TaKaRa, Japan), 300 ng/μl tracerRNA ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... All lentiviral particles were produced in Lenti-X 293T cells using the Lenti-X HTS Packaging System (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Plant Biology 2020Quote: ... The RAV1 motif enriched promoter sequence of each of the gene (Table S1) was cloned in pAbAi bait vector (Clontech, USA) in the upstream of Aureobasidine A ...
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T Lenti-X cells were purchased from Takara. Primary mouse melanoma cell lines were isolated from mouse melanomas ...
-
bioRxiv - Cell Biology 2019Quote: ... and concentrated 20x with Lenti-X Concentrator (Takara). Lentivirus was used immediately or kept at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Viruses were concentrated using Lenti-X Concentrator (Clontech). One volume of Lenti-X Concentrator was combined with three volumes of clarified supernatant ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and concentrated with Lenti-X concentrator (Takara Bio). Titration reactions using varying amounts of lentivirus were conducted on each cell type to determine the best volume to add ...
-
bioRxiv - Cell Biology 2022Quote: ... and Lenti-X 293T cells were from Clontech. No commonly misidentified cell line was used in this study ...
-
bioRxiv - Developmental Biology 2022Quote: ... were concentrated using Lenti-X− Concentrator (631232, Takara) and pellets were dissolved in 400 µl PBS.
-
bioRxiv - Developmental Biology 2022Quote: ... and titer estimation (Lenti-X Expression System, Clontech). An AAV virus that constitutively expresses eGFP from CMV promoter (Addgene ...
-
bioRxiv - Genomics 2019Quote: ... and concentrated 10x with Lenti-X (Clontech, 63123). 2×105 WT mESCs were incubated with 0.2 ml concentrated lentivirus and polybrene (8 μg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lenti-X 293T cells were obtained from Clontech, and maintained in DMEM media (Hyclone or Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: ... concentrated using the Lenti-X concentrator (Clontech, 631231), and stored at −80°C.
-
bioRxiv - Neuroscience 2020Quote: ... Lenti-X 293T cells (Cat. No. 632180, Clontech) were plated on 5-10 cm dishes ...
-
bioRxiv - Microbiology 2021Quote: ... and concentrated using Lenti-X-Concentrator (Takara Bio). Prior to infection of target cells ...
-
bioRxiv - Neuroscience 2020Quote: ... concentrated overnight at 4C with Lenti-X (Clontech) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lenti-x-293 Cell Line (Clontech Laboratories, 632180) were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Biochemistry 2020Quote: ... Lenti-X 293T cells (Takara Bio, MountainView, CA) were transiently transfected with 17.8 µg of pLKO.1 TRC-DsRed ...
-
bioRxiv - Cell Biology 2021Quote: ... concentrated using Lenti-X Concentrator (Takara Bio Europe) and titered on IMCD3 cells using GFP-expressing lentivirus ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Bioengineering 2022Quote: ... Lenti-X 293T cells were purchased from Takara and cultured according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lenti-X 293T cells were obtained from Clontech, and maintained in DMEM media (Hyclone or Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... Lenti-X 293T cells were purchased from Takara and cultured according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Viruses were concentrated using Lenti-X concentrator (Takara) and resuspended with phosphate-buffered saline ...