Labshake search
Citations for Takara Bio :
251 - 300 of 946 citations for Caspase 3 p12 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Molecular Biology 2019Quote: The transcription initiation and termination sites of OGRU were detected by 5’ and 3’ RACE using a SMARTer® RACE 5’/3’ Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... using the two-hybrid system Matchmaker 3 from Clontech, strain AH109 was co-transformed with derivates of pGBKT7-DS and pGADT7-Sfi (Appendix Table S4 ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA library was ligated to pGADT7-Rec vector to prepare recombinant AD construct using Make Your Own “Mate and Plate” Library system (Clontech). The yeast strain Y2H gold was co-transformed with bait and prey recombinant construct and colonies were screened against DDO (SD/-Leu/-Trp ...
-
bioRxiv - Plant Biology 2019Quote: 6His-GST-CRK2cyto and 6His-MBP-RBOHD/C constructs for recombinant proteins were generated by using In-Fusion technology (Clontech). The coding regions of CRK2cyto (WT ...
-
bioRxiv - Molecular Biology 2021Quote: ... sperm from 15 flies were dissected and pooled in 1:10 dilution of RNAse inhibitor (Recombinant ribonuclease inhibitor 5 000 U, Cat. 2313A Takara), and samples were flash-frozen on dry-ice ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were sorted into 96-well plates containing 4uL lysis buffer containing 4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV3 and harvested at DIV10 for qRT-PCR using SYBR green qPCR master mix (Takara). Total RNA was extracted from rat cortical neurons using the TRIzol reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV4 and harvested at DIV11 for qRT-PCR using SYBR green qPCR master mix (TaKaRa). Total RNA was extracted from mouse cortical neurons using TRIzol reagent (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: ... for about 60 minutes at 37°C and sorted into lysis buffer (4μl 0.5 U/μL Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transduced in 24-well plates precoated with recombinant fibronectin (FN CH-296, Retronectin Takara, Clontech, Mountain View, CA) with retroviral supernatants and expanded in complete medium (45% RPMI-1640 and 45% Click’s medium ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transduced in 24-well plates precoated with recombinant fibronectin (FN CH-296, Retronectin Takara, Clontech, Mountain View, CA) with retroviral supernatants and expanded in complete medium (45% RPMI-1640 and 45% Click’s medium ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, 0.4 U/μL Recombinant RNase Inhibitor [TaKaRa, Cat# 2313A]) as described previously [27] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The recombinant proteins were purified using a TALON Metal (Cobalt) Affinity Resin column (Clontech Laboratories, Inc., Palo Alto, CA, USA) and eluted with a linear gradient of imidazole (0–1,000 mM ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, and 0.4 U/μL Recombinant RNase Inhibitor [TaKaRa, Cat# 2313A]) [27] ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells and hippocampal neurons were transfected with plasmids encoding FM4 recombinant receptors for 15 h and then treated with 2 μM DD-Solubilizer (TakaraBio/Clontech) to induce the release of the receptors from the ER into the secretory trafficking ...
-
bioRxiv - Bioengineering 2024Quote: ... Appropriate colonies were grown and the recombinant bacmid DNA was extracted using the NucleoBond Xtra Midi plasmid purification kit (TAKARA). The fifth instar silkworm larvae ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:250; Clontech), mouse anti-ratCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-Dsred (1:250, Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:500; Clontech), mouse anti-rCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:1000, Clontech), mouse mAb anti-ChAT (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-RFP (1:1,000, Clontech), mouse monoclonal anti-Bruchpilot ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DesRed (Catalog #632392, Takara Bio USA ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-RFP 1:500 (Clontech), anti-GFP 1:1000 (Nacalai Tesque) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Dsred (1:200)(Takara), mouse anti-Lacz (1:200)(Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... DsRed (rabbit; 1:500, 632496 Takara), TH (mouse ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (Clontech, rabbit 1:500), anti-PV (Sigma PARV-19 ...