Labshake search
Citations for Takara Bio :
451 - 500 of 946 citations for Caspase 3 p12 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit-anti-DsRed (1:1000, Takara, 632496). After 3 washes in PBS ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit α-RFP (1:500; Clontech, cat# 632496, RRID:AB_10013483); mouse α-lacZ antibody (1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... and rabbit anti-DsRed (1:500, 632496, Takara Bio).
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit poly-clonal anti-GFP (1/800, 632592, Clontech), anti-Myosin heavy chain (1/10 ...
-
bioRxiv - Neuroscience 2021Quote: - 1/1000 Rabbit α-dsRed (Takara, Living Colors 632496)
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit-anti-RFP (1:500, Clontech 600-401-379); mouse-anti-24B10 (Zipursky et al. ...
-
Activity-regulated growth of motoneurons at the neuromuscular junction is mediated by NADPH oxidasesbioRxiv - Neuroscience 2022Quote: ... Rabbit-anti-dsRed (1:1000) (ClonTech Cat. No. 632496), Mouse nc82 (Bruchpilot ...
-
bioRxiv - Pathology 2022Quote: ... Primary antibodies: rabbit anti-DsRed express (Clontech, 1:250) and goat anti-HRP (Jackson Lab ...
-
bioRxiv - Neuroscience 2022Quote: ... dsRED (rabbit polyclonal, Living Colors, Clontech, Cat no. 632496); MAP2 (mouse monoclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DSred primary antibody 1:500 (Takara, 632496) which binds Td-tomato protein ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed 1:100 (Takara Bio Clontech 632496), mouse anti-mCherry 1:100 (Takara Bio Clontech 632543) ...
-
bioRxiv - Neuroscience 2023Quote: ... Ds-red polyclonal anti-rabbit (1:200; Takara, 632496). C1q monoclonal anti-rabbit (1:1000 ...
-
Brief Change in Dopamine Activity during Consolidation Impairs Long-Term Memory via Sleep DisruptionbioRxiv - Neuroscience 2023Quote: ... and rabbit anti-DsRed (1:200, Cat# 632496, Clontech). Secondary antibodies were Alexa Fluor 488 (goat anti-chicken ...
-
Brief Change in Dopamine Activity during Consolidation Impairs Long-Term Memory via Sleep DisruptionbioRxiv - Neuroscience 2023Quote: ... and rabbit anti-DsRed (1:200, Cat# 632496, Clontech); primary antibodies used to detect GRASP signals was mouse monoclonal anti-GFP (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit anti-dsRed (Takara 632496, 1:1,000–1:2,000), and Chicken anti-GFP (Aves GFP-1020 ...
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit anti-dsRed (Takara Bio 632393; 1:200). Then ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...