Labshake search
Citations for Takara Bio :
201 - 250 of 2479 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5’/3’ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier (UMI) ...
-
bioRxiv - Immunology 2021Quote: ... 5′-GTGCATGCGGAAACACGTGTCTGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro vector or RNase L targeting gRNA 5′-GTTATCCTCGCAGCGATTGCGGGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast was achieved using the In-Fusion enzyme mix (Clontech). OAS1 and RNASEL KO 293T were generated using lentiviral transduction as described previously followed by selection in 2 μg/mL puromycin or blasticidin (Lau et al. ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... was extracted and 5’ and 3’ rapid amplification of cDNA ends (RACE) was performed using the Smarter RACE kit (Clontech, 634858). cDNA was synthesized as described in the kit using 5′ and 3′ RACE CDS primers and SMARTer IIA oligo for template switching for 5′ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... the cDNA ends of both genes were obtained via 5’- and 3’-RACE using the SMARTer™ RACE cDNA amplification kit (Clontech, USA). Resulting PCR products were directly sequenced and full-length cDNAs of the putative mudskipper desaturase and elongase were constructed by aligning overlapped regions of the cDNA fragments.
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).