Labshake search
Citations for Takara Bio :
51 - 100 of 2479 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: The transcription initiation and termination sites of OGRU were detected by 5’ and 3’ RACE using a SMARTer® RACE 5’/3’ Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...